biyelunwen/97.reference_docs/bpp-4-manual/bpp-4-manual.md

266 KiB
Raw Permalink Blame History

BPP Documentation

BPP Explained

Overview

Bayesian Phylogenetics & Phylogeography (BPP) is a Bayesian Markov chain Monte Carlo (MCMC) program for analyzing DNA sequence alignments of multiple loci from multiple closely-related species under the multispecies coalescent (MSC) model (Yang 2002; Rannala and Yang 2003). See Xu 2016 and Rannala et al 2020 for reviews of the MSC model. The program requires 3 input files:

  1. Sequence data file (see Sequence File).

  2. Imap file specifying the population source of each sequence (see Imap file).

  3. Control file specifying other variables needed to run the program (e.g., initial species tree, prior distributions, etc)(see Control File).

This manual will provide details for creating these input files (describing syntax and permissible values for variables). The input files should be in text format and edited using a text format editor (for example, a Unix editor such as emacs, or vi). A basic set of map and control files using sensible default priors based on the sequence data can also be created using the web tool Minimalist BPP available at

https://brannala.github.io/bpps/

These auto-produced files can then be used as a template for more editing.

Possible types of analyses

The program can be used to conduct four different types of analyses, each specified using two variables in the control file:

  • A00 (speciesdelimitation = 0, speciestree = 0): estimation of species divergence times and population sizes under the MSC, IM and MSC-I models when the species tree is specified by the user (Rannala and Yang 2003; Flouri et al 2020)

  • A01 (speciesdelimitation = 0, speciestree = 1): inference of the species tree when sequences are assigned to species by the user (Rannala and Yang 2017)

  • A10 (speciesdelimitation = 1, speciestree = 0): species delimitation using a user-specified guide tree (Yang and Rannala 2010; Rannala and Yang 2013)

  • A11 (speciesdelimitation = 1, speciestree = 1): joint species delimitation and species tree inference using unguided species delimitation Yang and Rannala 2014

!!! tip "Which analysis should I use?" - A00: You know the species tree and want to estimate θ and τ - A01: You know the species assignments but want to infer the tree - A10: You have a guide tree and want to test species boundaries - A11: You want to jointly infer both tree and species boundaries

A detailed guide to the use of each of these 4 methods of analysis, as well as example control files, are provided in Methods of Analysis. The BPP tutorial also provides examples illustrating the four types of analyses (Yang 2015; Flouri et al 2020).

Model Parameters

The basic parameters in the MSC model include the species divergence times ( \tau ) and mutation scaled population sizes

\theta = 4N\mu

where N is the effective population size and \mu is the mutation rate per site per generation. Note that \theta specifies the average proportion of sites that have different bases when comparing two sequences sampled at random from the population. Both \tau and \theta are measured in units of expected number of mutations per site ( \tau can be converted to units of years if the substitution rate per site per year is known). For example, if \tau is an estimated divergence time in units of expected substitutions per site (from a BPP analysis) and the substitution rate per site per year is \mu, then the estimated divergence time in years is, \tau', is

\tau' = \frac{\tau}{\mu}

and the diploid effective population size is

N = \frac{\theta}{4\mu}

For a species tree with s species, there are (s 1) divergence times (\tau) and at most (2s 1) population size parameters (\theta). Analysis A00 estimates those parameters when the species delimitation and species tree are fixed (specified by the user). Analyses A01, A10, and A11 estimate parameters and model probabilities of the different MSC models. The multispecies-coalescent-with-introgression (MSC-I) model, first implemented in BPP version 4.1 and described in The MSC-I Model, adds introgression nodes to the tree, each with a new parameter, the introgression probability (\varphi) see Flouri et al 2020. The multispecies-coalescent-with--migration (MSC-M) model, first implemented in BPP version 4.6 and described in The MSC-M Model, adds a matrix of instantaneous migration rates (M). For reviews of the MSC model, see Yang 2014 (Chapter 9), Xu 2016 and Rannala et al 2020.

Model Assumptions

The MSC model implemented in BPP makes two basic assumptions about the data: no recombination between sites of the same locus, and free recombination between loci. The original MSC model (Rannala and Yang 2003) also assumes complete genetic isolation between populations, but more recent implementations allow gene flow between species (either continuous migration or episodic introgression); the MSC-I model implemented in BPP allows episodic introgression Flouri et al 2020 and the IM model allows continuous migration (see Introgression and Migration Models and Isolation With Migration Models). The default model assumes a strict molecular clock (constant substitution rates among lineages) and relaxed-clocks (with substitution rates varying among lineages) are implemented through variable clock models (see Substitution Models).

Nuclear genomic data

Ideal data for analysis using the BPP program are loosely-linked short genomic segments. Such data are likely to satisfy the model assumptions because intra-locus recombination is rare for short segments (500 to 1000bp) and distantly spaced segments undergo frequent recombination and thus have nearly independent histories. Genealogical trees are assumed to be a product of neutral evolution (not influenced by natural selection). However, protein-coding gene sequences appear to be useable in BPP analyses since most proteins are performing similar functions in closely related species and the main effect of purifying selection on nonsynonymous mutations is a reduction of the neutral mutation rate (Shi and Yang 2018; Thawornwattana et al 2018). It is a good idea to separate the noncoding and coding regions of the genome into two datasets.

The program allows the option of either a constant rate (strict molecular clock) or variable rates of substitution (relaxed molecular clocks) among lineages. Different substitution models are available, with the most complex (parameter rich) being the General Time-Reversible (GTR) model and the simplest the Jukes-Cantor (JC69) mutation model. All the models correct for multiple hits at individual sites (see Substitution Models). The use of the JC69 model and the strict molecular clock model should be limited to closely related species with sequence divergence not much higher than 10%. Sequences from distantly related species should be analyzed using a GTR substitution model in combination with one of the relaxed clock models (see Among-species rate variation. Models allowing substitution rate variation among sites (see Among-site rate variation) and among loci (see Among-locus rate variation)are also implemented in BPP (see Models of Substitution Rate Variation).

Mitochondrial data

The MSC model accommodates genealogical heterogeneity across the genome. Thus, different regions of the autosomal genome may have different gene tree topologies and branch lengths (coalescent times). While the mutational process may also vary along the genome, this heterogeneity is believed to be much less important. Thus multiple genes from the mitochondrial genome, which in most species does not undergo recombination, should be treated as one 'locus' in the MSC-based analysis. The mitochondrial genome often has a mutation rate that differs from the nuclear genome, as well as a different effective population size from that of autosomes. While the model of locus-rate variation (option variable locusrate) and the heredity scalar (option variable heredity) are designed to deal with this, it may be prudent to analyze the loci from the nuclear genome separately from the single mitochondrial locus.

Identical sequences and phylogenetic signal

The model implemented in BPP assumes that the sequences represent random samples from the different species. Sequences from the same species that are identical should all be used. It is incorrect to use only the unique haplotypes, which will lead to biased parameter estimates. Similarly, it is incorrect to filter loci based on bootstrap support values and use only those loci with a high "phylogenetic information" signal.

How to Cite BPP

If you publish results obtained using BPP you should cite the version number of the BPP release you used as well as the canonical citation, which as of release v4.3.8 is

Tomáš Flouri, Xiyun Jiao, Bruce Rannala, Ziheng Yang (2018) Species
Tree Inference with BPP Using Genomic Sequences and the Multispecies
Coalescent, Molecular Biology and Evolution 35: 2585--2593.

You can also cite the one of the BPP tutorials and the original papers describing the methods you used (see above). Be sure to state the priors that you used since they are necessary for reproducibility. If you conduct a joint analysis of species delimitation and species tree inference, your method description may look like the following (replace the specific values in bold with those you used):

"Joint Bayesian species delimitation and species tree estimation was conducted using the program BPP (Flouri et al., 2018; Yang, 2015). The method uses the multispecies coalescent model to compare different models of species delimitation (Yang and Rannala, 2010; Rannala and Yang, 2013) and species phylogeny (Yang and Rannala, 2014; Rannala and Yang, 2017) in a Bayesian framework, accounting for incomplete lineage sorting due to ancestral polymorphism and gene tree-species tree discordance. The population size parameters ($\theta$s) are assigned the inverse-gamma prior IG(3, 0.002), with mean 0.002/(31) = 0.001. The divergence time at the root of the species tree (\tau_0) is assigned the inverse-gamma prior IG(3, 0.004), with mean 0.002, while the other divergence time parameters are specified by the uniform Dirichlet distribution (Yang and Rannala, 2010, eq. 2). Each analysis is run at least twice to confirm consistency between runs.”

Features New To BPP 4.0

  • Multiple threads
  • Introgression models (MSC-I)
  • Migration models (MSC-M)
  • Local-clock and locus-rates models (clock and locusrate)
  • Topological constraints (constraint and outgroup)

Installing and Running BPP

This manual applies to BPP versions 4.1 and later. The program is written in C and executables are available for Windows, Mac OSX and Linux. Alternatively, the BPP program can be compiled for Unix (Linux, BSD, etc), Mac OSX, or Windows. If you are using a Windows, Mac OSX or Linux operating system (and you are not a programmer who prefers to compile from source) you should download the latest release executables for your machine (go to Obtaining BPP). If you have not used a command line program before, read Using the Command Line then go to Obtaining BPP. If you want to compile the program yourself (you must do this if you are using a Unix variant other than Linux or Mac OSX) go to Compiling the BPP Program.

Obtaining BPP

Executables and source code for the most recent BPP release are always available at:

https://github.com/bpp/bpp/releases/latest

Download the distribution file containing an executable for your operating system and uncompress the file. Change the current directory to be the root of the subdirectory created by uncompressing the file. For example, on a Linux machine you could type the following to download and install bpp version 4.8.0 (the latest version may be different from this):

wget https://github.com/bpp/bpp/releases/download/v4.8.0/bpp-4.8.0-linux-x86_64.tar.gz
tar -xzf bpp-4.8.0-linux-x86_64.tar.gz
cd bpp-4.8.0-linux-x86_64

You are now ready to proceed to BPP Trial Run

Using the Command Line

BPP is a command-line program, so the preferred way of running it is to open a terminal application and execute the program from the terminal command line, rather than double-clicking on the executable file in your file explorer. If you have not used the command line before, please work through one of the following short tutorials first:

Windows:
http://abacus.gene.ucl.ac.uk/software/CommandLine.Windows.pdf

Mac OSX:
http://abacus.gene.ucl.ac.uk/software/CommandLine.MACosx.pdf

Compiling the BPP Program

Requirements

To compile the program you will need to have a C compiler and the Make program installed on your machine. To test whether this software is installed (on a Unix machine) you can type:

cc --version; make --version

which should produce output similar to the following if a compiler is installed:

cc (Ubuntu 9.3.0-10ubuntu2) 9.3.0
Copyright (C) 2019 Free Software Foundation, Inc.
This is free software; see the source for copying conditions.  There is NO
warranty; not even for MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.

GNU Make 4.2.1
Built for x86_64-pc-linux-gnu
Copyright (C) 1988-2016 Free Software Foundation, Inc.
License GPLv3+: GNU GPL version 3 or later <http://gnu.org/licenses/gpl.html>
This is free software: you are free to change and redistribute it.
There is NO WARRANTY, to the extent permitted by law.

If instead you see an error message such as:

Command 'cc' not found

then you (or your system) administrator will need to install the compiler software (using a package manager such as apt on Ubuntu, for example) before you can compile BPP.

Downloading and compiling the source code

If you have the necessary software for compiling you can download the C source code for the latest release from:

https://github.com/bpp/bpp/releases/latest

The link to the source file on github is named Source code. You will need to download and uncompress the file, then change to the source code subdirectory before executing the commands outlined below. The program needs to be compiled only once. For example, the following commands use the gcc compiler to compile the program and move the generated executable file (bpp) into the bin/ folder.

cd bpp
mkdir bin
cd src
make
mv bpp ../bin

If you use git you can instead clone the bpp repository and check out the master branch (which contains source code for the latest stable version of bpp) and then compile the program:

git clone https://github.com/bpp/bpp.git
cd bpp
git checkout master
cd src
make

You are now ready to proceed to BPP Trial Run

BPP Trial Run

Run the program from the command line (rather than double-clicking the executable) so that you will see any potential error messages. Change your current directory to the top level of the directory created by uncompressing the bpp distribution file. For example, in Linux the following commands will uncompress the distribution file and move you to the top level of the bpp directory:

tar -xvzf bpp-4.8.0-linux-x86_64.tar.gz
cd bpp-4.8.0-linux-x86_64

In the bpp/ subdirectory, run the program in Windows by typing the following command within the Terminal application:

bin\bpp --cfile examples\frogs\A00.bpp.ctl

In Linux or Mac OSX type the following commands within a terminal:

cd examples/frogs/
../../bin/bpp --cfile examples/frogs/A00.bpp.ctl

If the program executed successfully, you should see initial output similar to the following:

bpp v4.8.0_linux_x86_64, 31GB RAM, 12 cores
https://github.com/bpp/bpp
	
Auto-selected SIMD ISA: AVX2
	

Starting timer..
Using seed: -1
Parsing species tree... Done
Parsing phylip file... Done

Alternatively, you may see one or more error messages. This may be due to a spelling error, or you may not be in the correct subdirectory. If this does not appear to be the case and the problem persists you can ask for help on the BPP discussion group at:

https://groups.google.com/forum/#!forum/bpp-discussion-group

When posting on the forum, please specify the exact command you typed and the error message you received (preferably by copying and pasting this information from your terminal or attaching a screen shot).

BPP Command-line Options

Below is a list of command-line options for running BPP.

General options:

Command-line option Meaning
With no options, bpp prints out the version number and computer hardware information
--help Display help information
--version Display version information
--quiet Only output warnings and fatal errors to stderr
--cfile FILENAME Run analysis for the specified control file
--simulate FILENAME Run simulation for the specified control file
--resume FILENAME Resume analysis from a specified checkpoint file
--msci-create FILENAME Construct an MSci graph using a definitions file
--summary FILENAME Summarize results using specified control file (no MCMC)

Advanced options:

Command-line option Meaning
--arch SIMD Force specific vector instruction set (default: auto)
--bfdriver FILENAME Create control files for marginal likelihood calculation
--points INTEGER Number of G-L quadrature points (used with --bfdriver)
--no-pin Do not pin threads to cores
--theta_mode INTEGER Definition of \theta step lengths (default: 2). 1: one step length for all \theta; 2: one step length for tip and one for inner nodes; 3: one step length for each node
--theta-prop STRING Proposal distribution for \theta gibbs move: 'mg_invg' or 'mg_gamma'
--theta-showeps Show individual step lengths/pjumps for each \theta
--theta-slide-prob FLOAT Frequency for \theta sliding window move (default: 0.1)
--phi-slide-prob FLOAT Frequency for \phi sliding window move (default: 0.1)
--wrate_mode INTEGER Definition of W step lengths (default: 1)
--wrate-slide-prob FLOAT Frequency for W sliding window move (default: 0.1)
--wrate-showeps Show individual step lengths/pjumps for each W
--extend INTEGER Extend resumed analysis by number of MCMC samples (use with --resume)
--keep-labels Keep original node labels when summarizing results

Input File Formats

Two input files are required for every BPP analysis, the sequence file and the control file. If more than one species is being analyzed an Imap file is also required. A few additional input files are required only when specific options are specified in the control file. Here we describe the content and format specifications of the sequence, Imap and control files that will be needed for most BPP analyses.

Sequence File

The sequence alignments must be in the phylip/paml format, with one alignment following the other, all in one file. An alignment is called a locus. Every locus must have at least 2 sequences, different loci can have different numbers of sequences, and some species may have no sequences present at some loci. In the phylip/paml format the first line of the entry for each locus contains two numbers specifying the number of sequences and the number of sites, respectively, that are present at the locus. A sequence name must precede each sequence entry and be separated from it by either a line break or two or more spaces. Each sequence name must contain an individual ID, which is unique among the sequences listed for a given locus, preceded by a caret ^ symbol. For example, the sequence name GI01234567^Specimen1 has the individual ID Specimen1. The label GI01234567 that precedes the ^ is optional, so ^Specimen1 is also a valid sequence name but Specimen1 is not. The sequences may be in interleaved format.

DNA bases can be specified using either upper or lower case letters, missing data can be specified using a ? symbol, and IUPAC ambiguity codes may be used. The interpretation of an ambiguity code (as either an uncertain base or a diploid genotype) depends on whether the data are specified as phased in the control file. By default (control file variable cleandata = 0, see Control File), alignment gaps and ambiguity nucleotides are used in the likelihood calculation, with gaps treated as question marks (see Yang 2014 pp. 111-112). If cleandata = 1, all columns with gaps or ambiguity characters are removed before analysis. An example of a sequence data file for 2 loci and 4 sequences per locus is given below (you can also examine the sequence files frogs.txt and yu2001.txt in the examples subdirectory).

    4 20

    dog^alfy1    attgtgccctctctctctca
    dog^alfy2    attgtgccctctctctctca
    cat^smoot    attgtgccctctagctctca
    human^ben    attgtgccctctgactctcc

    4 10

    dog^alfy1    attgtgccct
    dog^alfy2    attgtgccct
    fox^sample1  attgtgccct
    ^ben         attgtgaagt

Imap File

Each sequence name has an individual ID tag after the caret ^ symbol. For example, the sequence name GI01234567^Specimen1 has the individual ID Specimen1. An Imap file maps the individual IDs (specimens) to their species/populations. For example, the following Imap file maps Specimen1 to species A, Specimen4 to species B, and so on.

    Specimen1   A
    Specimen2   A
    Specimen3   A
    Specimen4   B
    Specimen5   C
    Specimen6   C

See also the map files frogs.Imap.txt and Rokas2003-5species-Imap.txt in the examples subdirectory. The MSC model implemented in BPP infers the relationships among species/populations not individuals and so it uses only the population ID for a sequence (such as A, B, ... in the example), and does not use the individual ID. Also when BPP reads the sequence names, it use the individual ID to retrieve the species ID for each sequence but then ignores the sequence name. One motivation for the use of the Imap file and this two-layer design is that one may wish to analyze the same sequence data with different population/species assignments of individual IDs. This can be achieved by editing the small Imap file rather than editing the larger sequence data file.

imap
An example Imap file showing the sequence ID in the Imap file corresponding to that in the sequence file. Note that the caret ^ symbol is not allowed in the sequence ID of the Imap file but is required in the sequence label in the sequence data file.

Outgroups and Constraints File

The outgroups and constraints file is optional and its name is specified in the control file by setting variable constraintfile to the name of the constraint file. Topological constraints on species trees can only be specified for analyses A01 (species tree inference with a fixed species delimitation) and A11 (joint species tree inference and species delimitation). See Methods of Analysis for a detailed description of the A01 and A11 methods of analysis. Note that species trees are always rooted in BPP, whether you use the clock or relaxed clock. The control variable constraintfile in the control file has the format

    constraintfile = constraints.txt

Inside the constraint file, three keywords are allowed: define, constraint, and outgroup. The define keyword is used to assign a name or alias to a clade, constraint defines a clade or subtree, and outgroup means that species not on the list (the ingroup species) form a clade.

    define g1 as (G,H);
    # identical to constraint (D,E,F,(G,H));
    constraint (D,E,F,g1);   
    outgroup A,B,C;
    constraint (A,B);

Either the equal sign (=) or spaces can be used to separate the keyword from the specified value. In the example above, there are eight species in the dataset: A, B, C, D, E, F, G, and H. Line 1 defines an alias g1 for clade (G,H), which may be used in subsequent define or constraint statements. Line 3 specifies A, B, C as the outgroups; this is interpreted to mean that species not on the list, (that is, D, E, F, G and H) form a clade. Since this information is already in line 2, line 3 has no effect in this case.

The modifier keyword NOT (case-insensitive) can be used with define to instead specify the complement of the species on the list. Suppose in the data we have 10 species of ratites (flightless birds), and two outgroup species, chicken and ostrich. You can specify the constraint as follows:

    define ratites as NOT (chicken, ostrich);
    constraint = (chicken, (ostrich, ratites));

Note that BPP interprets outgroup to mean that all species not on the list form a clade. In theory the outgroup keyword is unnecessary because you can always achieve the same thing by using define (especially with the NOT option) and constraint. However outgroup may be more convenient or explicit in some situations. If there are four species (A,B,C,D),

    outgroup = B,C,D;

achieves nothing since all the 15 rooted species trees are allowed, whereas

    outgroup = C,D;

means (A,B) form a clade so that 3 rooted species trees are allowed. Finally if multiple compatible constraints are specified, BPP merges them into one so that

    constraint (E,F,G,H);
    constraint (F,G,H);
    constraint (G,H);

is equivalent to

    constraint (E,(F,(G,H)));

If any two constraints are in conflict, BPP will abort with an error message. For example the following will cause an error.

    constraint = (E,F,G,H);
    constraint = (G,H);
    constraint = (F,G);

Date File

The date file is optional and its name is specified in the control file by setting variable datefile to the name of the date file. When using tip-dating, each sample has an associated sample age. The datefile assigns an age to the sample using the individual ID tag. The dates are in units before time present, so larger numbers are older. Any desired time units (e.g. years, thousands of year, etc) can be used so long as the mutation rate prior is on the same time scale (e.g. expected substitutions per year, expected substitutions per thousand years). For example, the following date file assigns specimen1 an age 500, specimen2 an age of 10000. The population name can be included before the caret ^ symbol or it can be excluded.

	A^specimen1 500
	specimen2 10000
	B^specimen3 45000
	B^specimen4 35000

Each line should have one individual followed by the sample age. Each sequence in the dataset must be included in the date file. Also see the date file mammoth/dates.txt in the examples subdirectory.

Control File

The control file specifies most aspects of a BPP analysis, including the names of input and output files, choices of models, prior distributions on parameters, etc. The format is line oriented, with each line specifying the value of a particular variable. The default control file name is bpp.ctl. Lines beginning with * or # are comments and are ignored by the program. Most often the order of the lines is unimportant, but there are exceptions (as explained below). Each non-commented line of the control file contains a variable name and an assignment of one or more values to the variable. The general syntax of a line in the control file is:

    variable = value

where variable is the name of a valid variable and value is a list of one or more permissible values for the variable. Most variable assignments follow this format --- the exceptions are described later. BPP has complicated dependencies among variables, both in terms of whether the variable needs to be defined (or has a default value when undefined) and what its permissible values are. Here we begin by defining all the variable names, the syntax of their arguments and permissible types (integers, floating point numbers, etc), and outline the structure of dependencies among variables

Symbol/Rule Definition
b Boolean (0,1)
+d Positive integer
f floating point number
s String (or character)
t Tree in Newick format
x* List of one or more elements of type x
y [z] z is a set of variables whose form is determined by y
(w,z) w and z are two different permissible types
y [(w,z)] whether w or z is the permissible type depends on value of y

Table 1. Symbols used to represent syntax and value types of variables in variable definitions.

Detailed definitions of all the control file variables are provided at the end of this section, ordered according to their indexes in Table 2 below. If you are impatient to get started using the program with worked examples, you might want to now skip ahead to Example control file which explains the control file variables in the context of a simple example dataset analysis. You can later consult this section regarding particular control file variables as the need arises.

Index Variable Values Condition Dependencies
1 seed (-d,+d) True None
2 usedata b True None
3 jobname s True None
4 seqfile s True <-16
5 finetune b [f*] True ->7
6 print b b b b b True None
7 burnin +d True <-5
8 sampfreq +d True None
9 nsample +d True None
10 species&tree +d s* +d* t True ->{11,15,24}
11 Imapfile s 10[1]>1 <-10
12 speciesdelimitation b [b f*] True ->14
13 speciestree b True ->13
14 speciesmodelprior +d 12[1]=1 OR 13[1]=1 <-{12,13}
15 phase b* 10[1] <-10
16 nloci +d True ->4 <-30
17 model s [s] True None
18 Qrates b +f +f +f +f +f +f 17=''7'' <-17
19 basefreqs b +f +f +f +f 17=''7'' <-17
20 alphaprior f f +d True None
21 cleandata b True None
22 thetaprior s [(f*, f f s)] True None
23 tauprior s f f True None
24 phiprior f f 10[4] <-10
25 locusrate +d [(f f f s, s, )] True <-26 ->26
26 clock +d [f f f s s] True <-25 ->25
27 heredity +d [(f f, s)] True None
28 checkpoint +d [(+d)] True None
29 constraintfile s True None
30 threads +d [ +d +d ] True ->16
31 datefile s 25[3] None

Table 2. Complete list of BPP control file variables. The column Variable contains the control file variable name, the column Values specifies (using symbols) the format of the values (symbols are defined in Table 1). The column Condition describes the conditions (if any) needed for the variable to be required. An entry of True in this column means that the variable is always required/defined although possibly not explicitly (there may be a default value). The column Dependencies lists the variables that either influence the variable (<-) or are influenced by the variable (->) with the variables denoted using their index from column Index.

Table 2 lists all the variables that can be defined in the BPP control file. The first column lists an index used to identify the variable in other columns of the table and to determine the order in which the variables are defined in subsequent text. The second column lists the variable name. The variable names are highlighted to indicate the structure of their dependencies among variables as follows:

  • Bold = variable always needs to be defined, has no default value, and does not depend on other variables.

  • Italic = variable always needs to be defined, has a default value if no value is provided in control file, and does not depend on other variables.

  • Solid background = whether variable needs to defined (and possibly also its permissible values) depends on the value of another variable.

  • Regular = variable always needs to be defined and has no default value but its permissible values depend on the value of another variable.

Column 3 lists the permissible types of each variable and the syntax for specifying arguments in defining the variable. The variable types are defined in Table 1.

Column 4 lists the condition (state of another variable) that either determines whether the variable on that line exists (solid background variables) or determines its permissible values (italic or regular variables). x [y] refers to value of argument y of the variable with index x. Column 5 lists indexes of variables that either are influenced by the variable (the notation ->[c,d] indicates that the variable influences variables c and d) or variables that influence the variable (the notation <-[a] indicates that variable a influences the variable). If you are writing a control file from scratch, these dependencies necessitate that you specify the bold variables first, followed by the italic (only needed if changing defaults) and then the solid background and regular.

BPP control file variables

Quick Reference Tables

The tables below provide a quick overview of all control file options. See the detailed sections that follow for complete documentation.

Basic Setup

Option Syntax Default Description
seed seed = -1 or seed = N -1 Random seed (-1 = auto-generate)
usedata usedata = 0|1|2 1 0: prior only, 1: likelihood+prior, 2: prior with fixed gene tree
jobname jobname = prefix Output file prefix (replaces deprecated outfile/mcmcfile)
seqfile seqfile = path Path to sequence alignment file
Imapfile Imapfile = path Path to individual-to-species mapping file
nloci nloci = N Number of loci to analyze

Analysis Type

Option Syntax Default Description
speciesdelimitation 0 or 1 [algorithm options] 0 0: fixed delimitation, 1: estimate delimitation
speciestree 0 or 1 0 0: fixed tree, 1: estimate tree
species&tree N name1 name2 ... counts ... (newick); Species names, sample counts, and tree

Analysis modes: A00 (0,0), A01 (0,1), A10 (1,0), A11 (1,1)

MCMC Settings

Option Syntax Default Description
burnin burnin = N Number of burn-in iterations
sampfreq sampfreq = N Sample every N iterations
nsample nsample = N Number of samples to collect
finetune finetune = 0|1: params... 1 Auto-tune (1) or manual step sizes
checkpoint checkpoint = N N Checkpoint frequency and number to keep
threads threads = N [N N] 1 Number of threads [start pin]
loadbalance none or zigzag none Thread load balancing strategy

Priors

Option Syntax Example Description
thetaprior invgamma a b [e] invgamma 3 0.002 Prior on θ (population size)
gamma a b gamma 2 100
beta p q l u beta 1 1 0 0.01
tauprior invgamma a b invgamma 3 0.03 Prior on τ (divergence times)
gamma a b gamma 2 100
phiprior beta a b beta 1 1 Prior on φ (introgression probability)
wprior wprior = a b wprior = 2 200 Prior on w (migration rate) — replaces migprior in v4.8.0

Substitution Model

Option Syntax Default Description
model model = name HKY JC69, K80, F81, HKY, T92, TN93, F84, GTR, or amino acid models
Qrates Qrates = 0|1|2 [a b] 0 Rate matrix: 0=fixed, 1=estimate, 2=prior
basefreqs basefreqs = 0|1|2 [params] 0 Base frequencies: 0=empirical, 1=estimate, 2=prior
alphaprior alphaprior = a b Gamma prior on α (rate variation among sites)
cleandata cleandata = 0|1 0 Remove ambiguous sites

Rate Variation

Option Syntax Default Description
clock clock = 1|2|3|4 [params] 1 1: strict, 2: independent rates, 3: correlated, 4: simple
locusrate locusrate = 0|1|2|3 [params] 0 0: equal rates, 1-3: variable rates among loci
heredity heredity = 0|1|2 [params] 0 Heredity multipliers for θ

MSC-I Model (Introgression) (v4.1+)

Option Syntax Description
hybridization source target as node1 node2 tau=y,y phi=f Define introgression event
bidirection pop1 pop2 as node1 node2 phi=f,f Bidirectional introgression

MSC-M Model (Migration) (v4.6+)

Option Syntax Example Description
wprior wprior = a b wprior = 2 200 Default gamma prior on w (v4.8.0+, replaces migprior)
migration migration = N migration = 2 Number of migration connections
source target [a b] [a_w] [pseudo_a pseudo_b] A C 2 100 Migration specification per connection
geneflow geneflow = 0|1 geneflow = 1 Enable gene flow estimation

Output Control

Option Syntax Default Description
print print = N N N N N 1 0 0 0 0 Control output: samples, locusrate, heredity, labels, genetrees
printlocus printlocus = N l1 l2 ... Print gene trees for specific loci

Other Options

Option Syntax Default Description
phase phase = 0|1 per species 0 Analytical phasing for diploid data
speciesmodelprior speciesmodelprior = N 1 Prior on species models (A10, A11)
constraintfile constraintfile = path Topological constraints file
datefile datefile = path Tip dates for dated-tip analysis
thetamodel linked-none|all|inner|msci|mscm linked-none Link θ parameters across populations
traitfile traitfile = path Trait data for morphological analysis

1 seed


seed = (-d,+d)

DESCRIPTION
Specifies the seed used for the random number generator.
VALUES
-d, use the wall clock (in Windows) or white noise (in Linux) to generate a seed (store seed in file SeedUsed).
+d, use +d as the seed.
DEFAULT
-1
COMMENTS
Using the same positive integer seed will produce identical results in different runs, which is useful for debugging, and using different positive integers in different runs produces different results. Using -d, for example, -1, the computer's entropy generator is used as a source for the seed, and different runs will produce different results. When evaluating MCMC convergence by comparing results across different runs be sure to use -d. The positive integer seed automatically generated when using option -d is stored in a file named SeedUsed and can be used explicitly to replicate a result.

!!! tip "Best Practice" Run each analysis at least twice using different seeds (seed = -1) to confirm that results are stable across runs. This helps verify MCMC convergence.

EXAMPLES

seed = -1
seed = 278

2 usedata


usedata = b

DESCRIPTION
Specifies whether data (likelihood+priors) are used in calculating probabilities during MCMC or only priors.
VALUES 0, use only the priors to calculate probabilities (likelihood constant). 1, use likelihood and prior probabilities. 2, use only the priors (like 0) but fix the gene tree topology. DEFAULT 1 COMMENTS The 0 option can be used for debugging, or examining priors. When using option 0 a MCMC run produces samples from the prior for each variable. Option 2 is similar to 0 but additionally fixes the gene tree topology during the MCMC run. EXAMPLES

usedata = 0
usedata = 1
usedata = 2

3 jobname


jobname = s

DESCRIPTION
Defines the job name, which serves as a prefix for all output files generated by the analysis, including the main output file and the MCMC sample file. VALUES
s, a string specifying the common prefix for all output files. This string may include a directory path. EXAMPLES

jobname = /home/mickey/mouse

The above will create several files such as:

/home/mickey/mouse.txt        # main output file
/home/mickey/mouse.mcmc.txt   # MCMC sample file
/home/mickey/mouse.SeedUsed   # seed information file

Additional files may be generated depending on the type of analysis.

NOTE: The options mcmcfile and outfile from previous versions are now obsolete and have been replaced by jobname. Using these deprecated options will result in an error.

4 seqfile


seqfile = s

DESCRIPTION
Sets the name of the file containing the sequence data to be the string s
VALUES
s, a string of characters specifying the directory path and name of file that contains the sequence data
EXAMPLES

seqfile = /home/mickey/mouse_seq.txt
seqfile = sequences.txt

5 finetune


finetune = b [key:val ...]

DESCRIPTION Determines whether step lengths in MCMC proposals are automatically optimized or manually set to fixed values. Step lengths can optionally be specified using a key:value format.

!!! warning "Syntax Change in v4.8.1" The finetune syntax changed in BPP v4.8.1. The old positional syntax (finetune = 1: 5 0.001 0.001 ...) is no longer supported. Use the new key:value format or simply finetune = 1 for default auto-tuning.

The available proposal keys are:

Key Parameter Proposal Description
Gage Node age on gene tree
Gspr Subtree pruning and regrafting move
tau Tau (divergence time)
mix Mixing step (jointly changing mu, tau and gene tree node ages)
lrht Locus rate and heredity
phis Introgression probability (phi)
pi Stationary frequencies of substitution model
qmat Q matrix elements of substitution model
alfa Alpha parameter of gamma model for rate variation among sites
mubr Mean branch rate (mu-bar)
nubr Variance of branch rates (nu-bar)
mu_i Locus-specific mu
nu_i Locus-specific nu
brte Branch rate

VALUES 0 Use fixed step lengths (no auto-tuning). Default step lengths are used unless overridden with key:value pairs. 1 Automatically optimize step lengths during burnin. This is the recommended setting. 0 key:val ... Use fixed step lengths with specified values. 1 key:val ... Auto-tune with specified initial step lengths. DEFAULT finetune = 1 (auto-tune with default initial values) DEPENDENCIES If auto-tuning is enabled (b = 1), then burnin must be > 200. COMMENTS For most analyses, simply using finetune = 1 is recommended. The program will automatically adjust step lengths during burnin to achieve good mixing. Custom step lengths are only needed for difficult analyses with poor convergence. EXAMPLES

finetune = 1                          # auto-tune with defaults (recommended)
finetune = 0                          # fixed defaults, no auto-tuning
finetune = 1 Gage:5 Gspr:0.001        # auto-tune with custom initial values
finetune = 0 Gage:5 Gspr:0.001 mix:0.3  # fixed custom values

6 print


print = b b b b b

DESCRIPTION
Specifies what information is saved to the output files during the MCMC.
VALUES
There are 5 boolean (0,1) variables that specify whether particular variables are saved to file (1) or not saved (0). From left to right: variable 1 specifies MCMC samples; variable 2 specifies locus-specific rate parameters (rate \mu_i, variance parameter \nu_i and species-tree branch rates for locus r_{ij}); variable 3 specifies locus-specific heredity scalars if those are estimated from the data; variable 4 specifies locus-specific gene trees; and variable 5 specifies locus-specific substitution-rate parameters (qmat for the Q matrix, freqs for base frequencies, and alpha for gamma rates for sites).
EXAMPLES

print = 0 1 1 1 0
print = 1 1 1 1 1

7 burnin


burnin = +d

DESCRIPTION
Specifies the number of burn-in iterations that are executed in the MCMC run before sampling begins.
VALUES
+d, a positive integer specifying the number of burn-in iterations.
DEPENDENCIES
If finetune = 1 (automatic optimization) then burnin has to be >200.
COMMENTS
The total number of MCMC iterations is burnin + nsample \times sampfreq.
EXAMPLES

burnin = 100
burnin = 10000

8 sampfreq


sampfreq = +d

DESCRIPTION
Specifies the interval at which samples from the MCMC are to be written to the MCMC output file specified by jobname.
VALUES
+d, a positive integer specifying the interval between samples from the MCMC.
COMMENTS
The total number of MCMC iterations is burnin + nsample \times sampfreq.
EXAMPLES

sampfreq = 2
sampfreq = 10

9 nsample


nsample = +d

DESCRIPTION
Specifies the number of samples from the MCMC that are to be written to the MCMC output file specified by jobname.
VALUES
+d, a positive integer specifying the number of MCMC samples.
COMMENTS
The total number of MCMC iterations is burnin + nsample \times sampfreq.
EXAMPLES

nsample = 5000
nsample = 25499

10 species&tree


species&tree = +d s*
+d*
t

DESCRIPTION
Specifies the number of species, the species names, the maximum number of sequences (at any locus) for each species, and the species tree in Newick format (or species graph in extended Newick format in models with introgression).
VALUES
+d, a positive integer specifying the total number of species. s*, a list of +d strings specifying the name of each species. +d*, a list of +d positive integers specifying the maximum number of sequences (at any locus) for each species. t, a tree (or graph) in Newick format (or Newick extended format) specifying the relationships among species (and possibly introgression events).
DEPENDENCIES
The variable Imapfile must be specified only when the number of species +d > 1. The length of the boolean array specified for variable phase is equal to the number of species +d. The variable phiprior must be specified only if t is an introgression graph.
COMMENTS
See the subsection Notation for trees and introgression graphs for details on the format of t. The role of t in the MCMC analysis depends on the value of the speciestree variable. If speciestree=1 the variable t specifies the starting tree for the MCMC analysis, otherwise if speciestree=0 it is the fixed tree used for estimating parameters or the fixed guide tree for species delimitation.
EXAMPLES

species&tree = 4 H C G O
1 1 1 1
(((H, C), G), O);

11 Imapfile


Imapfile = s

DESCRIPTION
Sets the path/name of the Imap file to be the string s.
VALUES
s, a string of characters specifying the directory path and name of a file that contains the species/sequence map information.
DEPENDENCIES
The variable Imapfile must be specified only when the number of species defined by the species&tree variable +d > 1.
COMMENTS
See Imap File for a complete description of the Imap file format.
EXAMPLES

Imapfile = /home/foo/bar_Imap.txt
Imapfile = Imap.txt

12 speciesdelimitation


speciesdelimitation = b [b f*]

DESCRIPTION
Specifies whether species delimitation is performed and if so specifies the parameters of the species delimitation rjMCMC proposal algorithm.
VALUES
0, specifies no species delimitation.
1 0 epsilon, specifies species delimitation with rjMCMC algorithm 0, with parameter \epsilon as specified in equations 3 and 4 of Yang and Rannala 2010. Reasonable values for \epsilon are 1, 2, 5, etc.
1 1 alpha m, specifies rjMCMC algorithm 1, with parameters \alpha and m as specified in equations 6 and 7 of Yang and Rannala 2010. Reasonable values are \alpha = 1, 1.5, 2, etc. and m = 0.5, 1, 2.
DEFAULT
0
DEPENDENCIES
If speciesdelimitation = 1 then speciesmodelprior must be defined.
EXAMPLES

speciesdelimitation = 1 0 2
speciesdelimitation = 1 1 2 1

13 speciestree


speciestree = b

DESCRIPTION
Specifies whether the species tree is estimated or fixed in the MCMC analysis.
VALUES
0, specifies that species tree is fixed.
1, specifies that species tree is estimated.
DEFAULT
0
DEPENDENCIES
If speciestree = 1 then speciesmodelprior must be defined.

COMMENTS
This option invokes the nearest-neighbor interchange (NNI) or subtree-pruning-regrafting (SPR) algorithm to propose changes to the species tree topology during the MCMC run.
EXAMPLES

speciestree = 1
speciestree = 0

14 speciesmodelprior


speciesmodelprior

DESCRIPTION
Specifies the prior distribution for rooted species trees and species delimitations.
VALUES
0, specifies equal probabilities for the labeled histories (rooted trees with the internal nodes ordered by age).
1, specifies equal probabilities for the rooted species trees.
2, specifies equal probabilities for the numbers of species (1/s each for 1,2,\ldots,s species given s populations) and divides the probability for any specific number of species among the compatible models (of species delimitation and species phylogeny) in proportion to the number of labeled histories.
3, specifies equal probabilities for the numbers of species (1/s each for 1,2,\ldots,s species given s populations) and divides the probability for any specific number of species among the compatible models (of species delimitation and species phylogeny) uniformly.
DEPENDENCIES
The variable speciesmodelprior must be defined if either (or both) speciestree = 1 or speciesdelimitation = 1. If speciestree = 1 and speciesdelimitation = 0 then only options speciesmodelprior = 0 or speciesmodelprior = 1 may be used.
COMMENTS
The priors specified by options 2 and 3 are described in Yang and Rannala 2014. The prior specified by option 3 may be suitable when there are many populations.
EXAMPLES

speciesmodelprior = 0
speciesmodelprior = 3

15 phase


phase = b*

DESCRIPTION
Specifies whether the sequence data for each species is phased.
VALUES
1, in position i of the list indicates that data is unphased for species i in the list of species in variable species&tree, otherwise 0 indicates it is phased.
DEFAULT
0
DEPENDENCIES
The number of boolean (0,1) variables in the list must equal the number of species d+ specified in the species&tree variable.
COMMENTS
If at position i the phase variable is 1, each sequence from species i is treated as an unphased diploid sequence, with heterozygous sites represented using the ambiguity characters YRMKSW. The missing data tokens N-? are allowed and are all treated as ?, but other ambiguity characters (HBVD) are not allowed.

For phasing, each sequence is expanded/resolved into two sequences, and the program averages over possible phase resolutions according to the approach of @Gronau2011. For example, a sequence R...Y with two heterozygous sites, R (meaning A/G) and Y (meaning C/T), has two possible phase resolutions:

  1. A...T and G...C

  2. A...C and G...T

A sequence with no heterozygous sites will be phased/resolved into two identical sequences. The MSC model effectively averages over different phase resolutions of the heterozygous sites in performing the likelihood calculation. The option may increase memory usage and CPU time considerably if many sequences exist with many heterozygote sites at a locus. If the phase variable for a species is 0, all sequences from that species are treated as resolved haplotype sequences, and ambiguities are interpreted in the usual way. For example, an ambiguity code Y at a position is interpreted to mean that one sequence exists with an uncertain nucleotide at that position that is either a T or a C. The program does not allow some sequences from a species to be phased and other sequences from that same species to be unphased.
EXAMPLES

phase = 0 0 0 0 1
phase = 1 1 1 1 1

16 nloci


nloci = +d

DESCRIPTION
Specifies the number of loci present in the sequence data file specified by variable seqfile that will be analysed.
VALUES
+d, a positive integer specifying the number of loci to be analyzed.
DEFAULT
If nloci is not specified, all the loci present in the sequence file specified by seqfile will be analysed.
DEPENDENCIES
nloci must be less than or equal to the number of loci available in the sequence file specified by seqfile.
COMMENTS
If nloci is less than the number of loci present in the file specified by seqfile only the first nloci present in that file will be analysed.
EXAMPLES

nloci = 1
nloci = 2000

17 model


model = s [s]

DESCRIPTION
Specifies the DNA substitution model (or amino acid substitution model) that will be used. For DNA sequences the simplest (default) model that can be chosen is the Jukes-Cantor (JC69) model and the most complex is the General Time-Reversible (GTR) model. A range of models of intermediate complexity are also available. For amino acid sequences, most of the commonly used amino acid substitution matrix models are available. If a model other than Custom is specified it will apply to all loci. If Custom filename is specified, an additional file filename must be provided that contains one or more lines with the format:

loci_indices data_type model

where loci_indices is an index or range of indexes for loci (indexed according to their order of occurrence in the sequence data file), data_type is either DNA or AA, and model specifies the substitution model variable for the indexed loci as described above. For example, the entry

1-10 DNA JC69
11 AA DAYHOFF

specifies that loci 1 to 10 comprise DNA sequences that will have the JC69 model applied to them, while locus 11 is an amino acid sequence that will have the DAYHOFF model applied to it.
VALUES
For DNA sequences: JC69, K80, F81, HKY, T92, TN93, F84, GTR.
For amino acid sequences: DAYHOFF, LG, DCMUT, JTT, MTREV, WAG, RTREV, CPREV, VT, BLOSUM62, MTMAM, MTART, MTZOA, PMB, HIVB, HIVW, JTTDCMUT, FLU, and STMTREV.
Among-locus model variation: Custom filename.
DEFAULT
JC69
DEPENDENCIES
If model = GTR the variables Qrates and basefreqs can be optionally defined which provide priors on the rate matrix and base frequencies, respectively (default priors will be used otherwise).
EXAMPLES

model = GTR
model = CPREV
model = Custom models.txt

18 Qrates


Qrates = b +f +f +f +f +f +f

DESCRIPTION
Specifies whether the exchangeability parameters in the GTR model are fixed or variable and either their fixed values or prior relative mean values.
VALUES
b, specifies either fixed (1) or variable (0) exchangeability parameters in the GTR model.
+f +f +f +f +f +f, specify the exchangeability parameters in the order a, b, c, d, e, f for TC, TA, TG, CA, CG, and AG, as described in Yang 2014.
DEFAULT
0 1 2 1 1 2 1
DEPENDENCIES
The variable Qrates is defined only if model = GTR.
COMMENTS
Two example cases are discussed here with either fixed, or variable rates. The following specifies fixed rates:

Qrates = 1  2 1 1 1 1 2

This specifies fixed rates at a = 2, b = c = d = e = 1 and f = 2, so that the transition rate is twice as high as the transversion rate, and the model corresponds to K80 or HKY. Note that only the relative rates matter, because the rate matrix (Q) is scaled so that the average rate (over the base frequencies) is 1 and branch lengths are measured in the expected number of mutations/substitutions per site. Nevertheless the program expects six rate parameters.

Qrates = 0  10 5 5 5 5 10 

This specifies variable rates with a prior on a, b, c, d, e that is a Dirichlet distribution for every locus. The above specifies Dir(10, 5, 5, 5, 5, 10), with parameters \alpha_a = 10, \alpha_b = \alpha_c = \alpha_d = \alpha_e = 10, and \alpha_f = 10. The rates generated from the Dirichlet sum to 1, and they are rescaled. Note that larger values for those parameters mean less variance, while the mean for a, say, is given by \alpha_a/\alpha with $\alpha = \alpha_a + \alpha_b + \alpha_c + \alpha_d + \alpha_e + \alpha_f$. This specifies an average transition/transversion rate ratio of 2 (if base frequencies are all fixed at \frac{1}{4}).
EXAMPLES

Qrates = 1 2 1 1 1 1 2
Qrates = 0 1 1 1 1 1 1

19 basefreqs


basefreqs = b +f +f +f +f

DESCRIPTION
Specifies whether the base frequency parameters are fixed or variable and either their fixed values or prior relative mean values.
VALUES
b, specifies either fixed (1) or variable (0) base frequency parameters in the GTR model.
+f +f +f +f, specify the base frequency parameters in the order TCAG.
DEFAULT
0 1 1 1 1
DEPENDENCIES
The variable basefreqs is defined only if model = GTR.
COMMENTS
The parameters \pi_T, \pi_C, \pi_A, \pi_G can be either fixed or variable with a prior specified by the Dirichlet distribution with \alpha parameters specifying the relative mean frequencies.
EXAMPLES

basefreqs = 1 0.15 0.35 0.15 0.35
basefreqs = 0 10 10 10 10

20 alphaprior


alphaprior = f f +d

DESCRIPTION
Specifies the prior probability density for the shape parameter controlling the pattern of among-site rate variation.
VALUES
f f +d, specify the \alpha_p and \beta_p parameters of the prior on the Gamma shape parameter and the number of rate categories ncatG, respectively.
DEFAULT
\alpha=\infty (no rate variation among sites)
COMMENTS
Among-site rate variation is assumed to follow a Gamma distribution with a mean of 1 and shape parameter \alpha. The variance of rates among sites is 1/\alpha and therefore a smaller \alpha specifies more rate variation. A discrete distribution is used to efficiently approximate the Gamma distribution and ncatG is the number of rate categories used in the approximation -- more rate categories provide a better approximation but incur greater computational expense. A value for ncatG of 4 is recommended. The prior on \alpha is also a Gamma distribution with parameters \alpha_p and \beta_p. The variance and mean of the prior on \alpha are:

\textrm{Mean}(\alpha) = \frac{\alpha_p}{\beta_p},

\textrm{Var}(\alpha) = \frac{\alpha_p}{\beta_p^2}

EXAMPLES

alphaprior = 1 1 4

21 cleandata


cleandata = b

DESCRIPTION
Specifies whether columns in the alignment which have gaps or ambiguity characters will be removed prior to analysis, or will instead be retained for use in the likelihood calculation.
VALUES
0, specifies that columns in the alignment which have gaps or ambiguity characters will be treated as missing data and used in the likelihood calculation.
1, specifies the removal of columns in the alignment which have gaps or ambiguity characters.
DEFAULT
0
EXAMPLES

cleandata = 1
cleandata = 0

22 thetaprior


thetaprior = s [(f*, f f s)]

DESCRIPTION
Specifies the distribution model and parameters of the prior distribution on the contemporary and ancestral population parameters \theta and whether the MCMC integrates over the parameters or the integration is instead performed analytically.
VALUES
s, specifies the form of the prior distribution on theta and should be either invgamma, gamma or beta to specify either an inverse gamma, gamma, or beta distribution, respectively. [(f*, f f s)], specifies the parameters of the prior distribution. The form for the parameters depends on the type of distribution specified in the first argument. The permissible combinations of distributions and parameters are:

    invgamma a b
    invgamma a b e

which specifies an inverse gamma prior with \alpha and \beta parameters a and b, respectively. The first entry specifies that $\theta$s are integrated over analytically and the second entry (with trailing e) specifies that $\theta$s are estimated.

    gamma a b

which specifies a gamma prior with \alpha and \beta parameters a and b, respectively.

    beta p q l u

which specifies a beta prior constrained to the interval (l,u) with parameters p and q, respectively. All the distributions above, except the inverse Gamma distribution (without the e argument) integrate over the \theta parameters numerically as part of the MCMC, estimating the posterior distribution of \theta for each population.
COMMENTS
The inverse-gamma prior invgamma a b, where a and b are the parameters \alpha and \beta, has mean and variance:

\textrm{Mean}(\theta) = \frac{\beta}{\alpha - 1},

\textrm{Var}(\theta) = \frac{\beta^2}{(\alpha - 1)^2 (\alpha - 2)}.

For example, if \alpha=3 and \beta=0.002 the mean is 0.002/(3 1) = 0.001 (one variable site per kb on average). Note that all \theta parameters in the MSC model (for both modern species and extinct ancestral species) are assigned the same specified prior distribution with identical parameters. The inverse-gamma is a conjugate prior for \theta (Hey and Nielsen, 2007), which means that both the prior and the posterior of \theta will be inverse-gamma. Use of the conjugate prior allows the \theta parameters to be integrated out analytically, and thus the dimension of the parameter space is reduced. This typically leads to improved mixing of the MCMC.

!!! note "Trade-off: Analytical Integration vs. Posterior Estimation" Using invgamma a b (without e) integrates θ analytically for better MCMC mixing, but you won't get posterior distributions for θ. To estimate θ posteriors, use invgamma a b e instead.

To estimate the \theta parameters when using an inverse gamma prior, add the letter e (or E) on the line, as follows

    thetaprior = 3 0.002 e

Whether $\theta$s are integrated out or estimated, other results (such as the posterior probability of species trees or species-delimitation models) should be identical if the same prior is used. The analytical integration of \theta is only possible with an inverse gamma prior distribution, if any other prior is used the $\theta$s are automatically estimated and the E flag is not needed and should not be used. The gamma prior gamma a b, where a and b are the parameters \alpha and \beta, has mean and variance:

\textrm{Mean}(\theta) = \frac{\alpha}{\beta},

\textrm{Var}(\theta) = \frac{\alpha}{\beta^2}.

For example, if \alpha=0.001 and \beta=1 the mean is 0.001/1 = 0.001 (one variable site per kb on average). The beta prior beta p q l u has mean and variance:

\textrm{Mean}(\theta) = \frac{p u + q l}{p + q},

\textrm{Var}(\theta) = \frac{p q (u - l)^2}{(p + q)^2 (p + q + 1)}.

For example, with beta 2 18 1e-6 0.1 the mean is:

\frac{2(0.1)+18(10^{-6})}{2+18} = 0.0100009

which is 10 variable sites per kb on average.
EXAMPLES

thetaprior = invgamma 3 0.002
thetaprior = invgamma 4 0.001 e
thetaprior = beta 2 18 1e-6 0.1
thetaprior = beta 2 18 1e-6 0.01
thetaprior = beta 1 10 0.0001 0.2
thetaprior = gamma 0.001 1

23 tauprior


tauprior = s f f

DESCRIPTION
Specifies the prior probability distribution of the divergence time parameter for the root in the species tree. VALUES
s f f, specifies either the gamma or inverse gamma prior distribution and the \alpha and \beta parameters, respectively for \tau_0, the divergence time parameter for the root in the species tree.

    gamma a b
    invgamma a b

specifies a gamma distribution, or an inverse gamma distribution, respectively with a and b to be the parameters \alpha and \beta, respectively.
COMMENTS
If the specified prior on \tau_0, the age of the root of the tree is an inverse-gamma distribution IG(\alpha, \beta) with \alpha > 2 the mean and variance are:

\textrm{Mean}(\tau_0) = \frac{\beta}{\alpha - 1},

\textrm{Var}(\tau_0) = \frac{\beta^2}{(\alpha - 1)^2 (\alpha - 2)}.

If the prior is a gamma distribution the mean and variance are:

\textrm{Mean}(\tau_0) = \frac{\alpha}{\beta},

\textrm{Var}(\tau_0) = \frac{\alpha}{\beta^2}.

The remaining species divergence times are generated from the uniform Dirichlet distribution [@Yang2010 eq. 2]. As an example, suppose that tauprior = 3 0.03 specifies the prior for \tau_0, the divergence time parameter for the root in the species tree. The mean of \tau_0 is then 0.03/(3 1) = 0.015 (which means 1.5% of sequence divergence between the root of the species tree and the present time). If the mutation rate is 10^{9} mutations/site/year, this distance will translate to an absolute prior mean divergence time of 15 MY.
EXAMPLES

tauprior = invgamma 3 0.03
tauprior = gamma 0.01 1

24 phiprior


phiprior = f f

DESCRIPTION
Specifies the parameters of the prior distribution on \varphi, the introgression probability under the MSC-I model.
VALUES
f f, specify the parameters \alpha and \beta, respectively, of the beta distribution prior \textrm{B}(\alpha,\beta) for \varphi.
DEPENDENCIES
If the species&tree variable t specifies a tree with introgression nodes then phiprior must be defined.
COMMENTS
The introgression probability \varphi takes values on the interval (0,1) and the prior distribution for \varphi is assumed to be beta \textrm{B}(\alpha, \beta) which has mean and variance:

\textrm{Mean}(\varphi) = \frac{\alpha}{\alpha+\beta},

\textrm{Var}(\varphi) = \frac{\alpha \beta}{(\alpha + \beta)^2 (\alpha + \beta + 1)}.

For example, phiprior = 1 1 specifies the beta prior \textrm{B}(\alpha,\beta) with \alpha = 1 and \beta = 1 for \varphi, which has a mean of 1/2 and a variance of 1/12.
EXAMPLES

phiprior = 1 1
phiprior = 1.5 1.5

25 locusrate


locusrate = d+[(f f f s, s)]

DESCRIPTION
Specifies the model of substitution rate variation among loci, as well as the parameters, and the prior on the parameters of the model.
VALUES
d+[(f f f s, s)], specifies the model and parameters. The variable d+ takes one of 4 possible values with different numbers of additional variables depending on d+. The permissible combinations are:

d+ [args] Description
0 Loci have identical rates
1 f f f s Locus rates variable and estimated
\alpha_{\bar{\mu}} \,\, \beta_{\bar{\mu}} \,\, \alpha_{\mu_i} prior
2 s Locus rates variable and specified
Filename of file containing locus rates
3 f f Loci have identical rates. The rate is estimated using tip-dating
\alpha \beta

where \alpha_{\bar{\mu}} and \beta_{\bar{\mu}} are the parameters of the Gamma distribution prior on the average rate among loci \bar{\mu} and \alpha_{\mu_i} is the parameter of the prior on the rate at the i$th locus given \bar{\mu}$. The prior variable must be either iid for a conditional iid (hierarchical) prior on \mu_i or dir for a Gamma-Dirichlet prior. The prior variable is optional, if it is not specified iid is used.
DEFAULT
0
DEPENDENCIES
If both the prior option for the variable locusrate and the prior option for the variable clock are set, they should take the same value. If the locusrate = 3 f f option is used, datefile must be specified. COMMENTS
The setting locusrate = 0 (default) means that all loci have the same mutation rate. Setting locusrate = 1 f f f s specifies a model with rate variation among loci in which rates are estimated from the sequence data. Including the first integer (1) which species the model there are 5 arguments, the last one (prior) being optional. Parameters \alpha_{\bar{\mu}} and \beta_{\bar{\mu}} specify the shape and rate parameters of the gamma distribution for the mean rate across loci (\bar\mu), while \alpha_{\mu_i} and prior are used to specify the locus rates (\mu_i) given the mean rate (\bar\mu). The option prior can take two values dir (for Gamma-Dirichlet rates for loci), and iid (for conditional i.i.d. or hierarchical prior). locusrate = 2 LocusRateFileName specifies the fixed-rates model of locus-rate variation (Burgess and Yang 2008). This is the strategy used by Yang 2002, with the relative rates estimated by the distance to an outgroup species. The relative locus rates are listed in the file: there should be as many numbers in the file, separately by spaces or line returns, as the number of loci (nloci). The program re-scales those rates so that the average across all loci is 1 and then use those relative rates as fixed constants. Specifically the mean rate across loci (\bar{\mu}) is assigned a gamma prior:

\bar{\mu} = \mathrm{G}(\alpha_{\bar{\mu}},\beta_{\bar{\mu}}),

with mean and variance:

\textrm{Mean}(\bar{\mu}) = \frac{\alpha_{\bar{\mu}}}{\beta_{\bar{\mu}}},

\textrm{Var}(\bar{\mu}) = \frac{\alpha_{\bar{\mu}}}{\beta_{\bar{\mu}}^2}.

When there are no fossil calibrations in the species tree, the rates should all be relative. In this case we suggest fixing \alpha_{\bar{\mu}}=\beta_{\bar{\mu}}=0 (with 0 causing the program to fix both parameters at \infty), and the program will fix the mean rate across loci at \bar\mu = 1. Otherwise one can use equal and large values such as \alpha_{\bar{\mu}}=100 and \beta_{\bar{\mu}}=100, so that \bar\mu is nearly fixed at 1. Given the mean rate \bar\mu, two priors are available to specify the locus rates \mu_i, with i = 1, 2, \cdots, L, where L is the number of loci (nloci). If prior = dir (for Gamma-Dirichlet distribution of locus rates), the total rate L\bar\mu, given the mean rate (\bar\mu), is partitioned into locus rates (\mu_i), using the concentration parameter \alpha_{\mu_i} The model and notation follow Burgess and Yang 2008 [eq. 4] and Dos Reis et al 2014 [eqs. 3-5]. If prior = iid (for conditional-i.i.d. or hierarchical prior of locus rates), the locus rates (\mu_i) are i.i.d. given the mean rate (\bar\mu):

\mu_i \sim \mathrm{G}(\alpha_{\mu_i},\alpha_{\mu_i}/\bar{\mu}).

This model is described in Zhu et al 2015 [eq. 8] and is also implemented in [mcmctree]{.smallcaps}. In both the Gamma-Dirichlet and the conditional i.i.d. models, parameter \alpha_{\mu_i} is inversely related to the extent of rate variation among loci, with a large \alpha_{\mu_i} meaning similar rates among loci. If all loci are noncoding, the rates are probably similar, so \alpha_{\mu_i} = 10 or 20 may be reasonable, while for coding loci or exons, \alpha_{\mu_i} = 2 or 1 may be appropriate. The \alpha_{\mu_i} parameter may affect the estimates of the population size parameter (\theta) for the root node on the species tree (Burgess and Yang 2008). The L locus rates (\mu_i) are parameters in the model. If \alpha_{\bar{\mu}} > 0, the mean rate (\bar\mu) is a parameter as well.

The setting locusrate = 3 f f means the all loci have the same mutation rate, and the rate is estimated using tip-dating. The rate prior is \Gamma (\alpha, \beta). The units of the prior should match the units in the datefile. For example, if the dates are specified in years, the rate should be in expected number of substitutions per year.

EXAMPLES

locusrate = 0
locusrate = 2 rates.txt
locusrate = 1 0 0 2
locusrate = 1 2 3 2 dir
locusrate = 1 1 1 1 iid
locusrate = 3 20 1000000

26 clock


clock = +d [f f f s s]

DESCRIPTION
Specifies whether a strict molecular clock (equal substitution rates among lineages) is used or instead a specific variable clock model (allowing variation in substitution rates among lineages). If a variable clock model is specified, the priors on the parameters of the variable clock model are also specified.
VALUES +d, specifies a strict clock (1), a variable clock with independent rates among branches (2), a variable clock with autocorrelated rates between ancestral and descendent branches (3), or a simple variable clock model (4).
f f f s s, are required when clock = 2 or 3 and specify respectively the parameters \alpha_{\bar{\nu}}, \beta_{\bar{\nu}} and \alpha_{\nu_i}, the prior distribution for the locus rate (\mu_i) which is either dir for Dirichlet or iid for conditional i.i.d (hierarchical) prior, and the distribution for the branch rates (r_{ij}) given the locus rate (\mu_i) which is either G for Gamma or LN for log-normal. Parameters \alpha_{\bar{\nu}} and \beta_{\bar{\nu}} are the parameters of the gamma distribution for the average of variances across loci (\bar\nu), while \alpha_{\nu_i} and prior are used to specify the variance (\nu_i) for locus i given the average (\bar\nu). The specification of the distribution of \nu_i given \bar\nu follows the same procedure as the specification of the distribution of \mu_i given the mean rate \bar\mu when modeling among-locus rate variation; see notes above about the locusrate variable. f f, are required when clock = 4 and specify the parameters \alpha_{\bar{\nu}} and \beta_{\bar{\nu}} for the simple rates model.
DEFAULT
1
DEPENDENCIES
If both the prior option for the variable locusrate and the prior option for the variable clock are set, they should take the same value.
COMMENTS
As an example, the specification (clock = 2 10.0 100.0 5.0 iid G) specifies a local-clock model in which the mutation rate drifts over branches, independently among loci. A detailed explanation is as follows. First \bar\nu is assigned a gamma distribution G(10.0, 100.0), with mean 0.1. Given \bar\nu, the conditional i.i.d. prior means that \nu_i \sim G(\alpha_{\nu_i}, \alpha_{\nu_i}/\bar\nu) with shape parameter \alpha_{\nu_i} = 5.0 and mean \bar\nu, for i = 1, 2, \cdots, L. Note that \alpha_{\nu_i} is inversely related to the variance of \nu_i: use small values of \alpha_{\nu_i} (2, 1, or 0.5) if you believe that \nu_i varies among loci (meaning that the clock nearly holds at some loci but is seriously violated at others).

As another example, the specification (clock = 2 10.0 100.0 5.0 dir LN) means that \bar\nu is assigned a gamma prior G(10.0, 100.0), and then the sum L\bar\nu is partitioned into \nu_i (for i = 1, 2, \cdots, L) according to the Dirichlet distribution (prior = dir) with concentration parameter \alpha_{\nu_i} = 5.0. Again large \alpha_{\nu_i} means the same extent of clock violation at different loci.

Given the locus rate \mu_i (specified using the locusrate variable) and the variance \nu_i (specified using the clock variable) for locus i, the different lineages may have different rates at the locus, and those rates are independent among loci. If distribution specified is G (for gamma), the rate for species-tree branch j at locus i has the following gamma distribution

r_{ij} | \mu_i, \nu_i \sim \mathrm{G}(\mu_i^2/\nu_i, \mu_i/\nu_i).

This has mean \mu_i and variance \nu_i. Alternatively if distribution = LN (for log-normal), the rate for species-tree branch j at locus i has the following the log-normal distribution

r_{ij} | \mu_i, \nu_i \sim \mathrm{LN}(\mu_i, \nu_i),

where \mu_i is the mean of the LN distribution and \nu_i is the variance parameter of the lognormal. Note that the rate-drift model specifies rates for branches on the species tree (rather than on the gene tree) for each locus, and gene-tree branches residing in the same population or species have the same rate. For example, if all sequences at a locus are from the same species and all coalescent events occur in that species (before reaching an ancestral species), all branches on the gene tree will have the same rate even if the relaxed-clock model allows rates among species. In contrast, if a gene-tree branch passes several species or populations, the different segments of the branch will have different rates. The branch length on the gene tree is calculated by summing up the lengths of those segments (with the length of each segment being the product of the rate and the time duration for the segment).

The option clock = 3 is similar to clock 2 but specifies the autocorrelated-rates model. clock = 3 with the log-normal distribution (LN) specifies the geometric Brownian motion model of Rannala and Yang 2007. This assigns a rate to each species-tree branch, that is, to the mid-point of the branch. Given the rate at the species-tree root (\mu_i at locus i), the rates for the two branches around the root are specified. Then given the rate for each ancestral branch, the rates for its two daughter branches are specified, by integrating over the rate at the internal node that is ancestral to the daughter branches. See figure 1 and equations 3-8 in Rannala and Yang 2007. The rates for all species-tree branches are thus assigned through a pre-order tree traversal, starting from the root moving to the tips, until all branches are visited. If clock = 3 is specified with the gamma distribution (option G), the model works as follows, using a similar pre-order tree traversal. First the two branches at the species-tree root have the gamma distribution with mean \mu_i and variance \nu_i. Then given the rate for each ancestral branch, the rates for its two daughter branches are specified as independent gamma variables with the mean to be the rate of the parental branch and with the variance to be \nu_i. Clock 3 is currently implemented for the MSC model only and is unavailable under the MSC-I model.

Note that a larger variance \nu_i implies a more serious violation of the molecular clock at locus i. Also note that \nu_i will be similar to \bar\nu, especially if \alpha_{\nu_i} is large, and \bar\nu has prior mean \alpha_{\bar{\nu}} / \beta_{\bar{\nu}}. If \alpha_{\bar{\nu}} = 10 and \beta_{\bar{\nu}} = 100, the prior mean will be 0.1. Thus, for the log-normal model \nu = 0.5 represents a serious violation of the clock while \nu < 0.1 represents only a slight violation.
EXAMPLES

clock = 1
clock = 2 10.0 100.0 5.0 dir LN
clock = 3 10.0 50.0 3.0 dir G

27 heredity


heredity = +d [(f f, s, )]

DESCRIPTION
Specifies whether proportional differences exist between all \theta values for different loci, and if so whether the proportionality multipliers (called inheritance scalars) are estimated from the data, or set to specified fixed values. If inheritance scalars are estimated, the parameters of the prior also must be specified.
VALUES
+d, specifies whether no differences in \theta exist among loci (0), proportional differences exist and inheritance scalars are estimated (1), or proportional differences exist and inheritance scalars are fixed to specified values (2).
f f, is only specified when +d is 1 and specifies the \alpha and \beta parameters, respectively, of the Gamma prior on the scalar s_i for locus i.
s, is only specified when +d is 2 and specifies the name of a file containing L (number of loci) heredity scalars (which must be positive numbers) separated by spaces or linebreaks.
DEFAULT
0
COMMENTS
heredity = 0 is the default and constrains \theta to be equal across loci. heredity = 1 or 2 specifies two models that allow \theta to vary among loci, which may be useful for analyses combining data from autosomal loci, loci on sex chromosomes, and/or mitochondrial loci. Such mixed data, may be expected to have proportional differences in effective population sizes among loci so that inheritance scalars Hey and Nielsen 2004 should be applied. For example, in diploid sexual organisms with strict maternal inheritance of mtDNA we expect the effective population size of a mitochondrial locus to be 1/4 that of a nuclear locus. Other factors such as natural selection may also cause \theta to deviate from the neutral expectation even among autosomal loci. BPP implements two options for allowing such variations. The first option (heredity = 1) specifies that locus-specific inheritance scalars s_i be estimated, using a Gamma prior with parameters \alpha and \beta specified by the user. The prior mean and variance of s_i are:

\textrm{Mean}(s_i) = \frac{\alpha}{\beta},

\textrm{Var}(s_i) = \frac{\alpha}{\beta^2}.

For example, (heredity = 1 4 4) specifies a Gamma prior \textrm{G}(4, 4), with mean 4/4 = 1 and variance 1/4, for the inheritance scalar at each locus. The MCMC then generates the posterior distribution of s_i for each locus. The second option (heredity = 2) allows the user to specify the s_i in a file so they remain fixed constants during the MCMC run.
EXAMPLES

heredity = 0
heredity = 1 4 4
heredity = 2 scalars.txt

28 checkpoint


checkpoint = +d [(+d)]

DESCRIPTION
Specifies whether one or more checkpoint files are created to allow the BPP program to resume using the current state of the MCMC at the iteration during which the checkpoint file was created.
VALUES
+d[(+d)], specifies the iteration at which the first checkpoint file is created (first argument) and how frequently checkpoint files are subsequently created (second optional argument).
DEFAULT
If the checkpoint value is undefined no checkpoint file is created.
COMMENTS
The checkpoint files are named JOBNAME.Z.chk where JOBNAME is the name specified by the jobname variable and Z is the number of the checkpoint file (the first checkpoint file is labeled 1, the second 2, and so on). To resume execution of the program starting from a checkpoint use the BPP resume switch followed by the checkpoint file name. For example, bpp resume outrun1.1.chk.
EXAMPLES

checkpoint = 100000
checkpoint = 100000 10000

29 constraintfile


constraintfile = s

DESCRIPTION
Specifies the name of a file containing information for placing topological constraints on inferred trees and specifying outgroups for tree rooting.
VALUES
s, a string specifying the name of the constraint file.
DEFAULT
If constraintfile is undefined no constraints or outgroups are used in the analysis.
EXAMPLES

constraintfile = myconstraints.txt

30 threads


threads = +d [+d +d]

DESCRIPTION
Specifies the number of CPU threads to be used and optionally the specific threads to be used.
VALUES
+d [+d +d\], either 1 or 3 positive integers. A single integer argument specifies the number of threads to use. If three integers are given the first specifies the number of threads, the second specifies the index of the first thread used and the third specifies the increment. For example, 12 4 1 specifies that 12 threads should be used, the first with index 4 and incrementing by one so that threads 4-15 are used.
DEFAULT
If threads is undefined, the calculations for each locus are placed on different threads when possible.
DEPENDENCIES
The number of specified threads cannot exceed the number of loci specified.
EXAMPLES

threads = 4
threads = 8 4 1

31 datefile


datefile = s 

DESCRIPTION
Sets the path/name of the date file to be the string s

VALUES
s, a string specifying the name of the date file.

DEFAULT
If datefile is undefined, no tip dates are used in the analysis.

DEPENDENCIES
Model A00 must be used with tip-dating (speciesdelimitation = 0, speciestree = 0). Checkpointing cannot be used. The tip-dating locusrate option must be used, locusrate = 3 d d. A global clock must be used. This is the default or can be set with clock = 1.

COMMENTS
See Date File for a complete description of the date file format.

EXAMPLES

datefile = dates.txt
datefile = /home/foo/seqDates.txt

32 thetamodel


thetamodel = s

DESCRIPTION Specifies how theta parameters are linked across populations in the species tree. VALUES linked-none, no linking of theta parameters (default). linked-all, all populations share the same theta. linked-inner, inner (ancestral) populations share the same theta. linked-msci, linking appropriate for MSC-I models. linked-mscm, linking appropriate for MSC-M models. DEFAULT linked-none EXAMPLES

thetamodel = linked-none
thetamodel = linked-all
thetamodel = linked-inner

33 printlocus


printlocus = +d +d +d ...

DESCRIPTION Specifies which loci should have their gene trees printed to the output. VALUES The first integer specifies the number of loci to print, followed by the locus numbers (1-indexed). EXAMPLES

printlocus = 2 1 5    # print gene trees for loci 1 and 5
printlocus = 3 1 2 3  # print gene trees for loci 1, 2, and 3

34 geneflow


geneflow = b

DESCRIPTION Enables or disables gene flow estimation in the model. VALUES 0, disable gene flow estimation. 1, enable gene flow estimation. DEFAULT 0 EXAMPLES

geneflow = 0
geneflow = 1

35 loadbalance


loadbalance = s

DESCRIPTION Specifies the load balancing strategy for distributing computation across threads. VALUES none, no dynamic load balancing (static distribution). zigzag, use zigzag load balancing for better distribution of work across threads. DEFAULT none EXAMPLES

loadbalance = none
loadbalance = zigzag

36 traitfile


traitfile = s

DESCRIPTION Specifies the file containing trait data for morphological analysis. VALUES s, a string specifying the path to the trait data file. EXAMPLES

traitfile = traits.txt
traitfile = /home/user/data/morphology.txt

Example control file

To examine the structure of a typical BPP control file, we consider the example file A00.bpp.ctl contained in the BPP distribution subdirectory examples/frogs. The goal here is to provide an example of a correctly formatted control file and briefly explain the syntax and meaning of specified variables, as well as proposing some conventions for writing optional comments in control files. An exhaustive description of all control file variables, their effects, and permissible values is provided in the definitions of BPP Control File Variables. In depth descriptions of specific model and prior choices can be found in Substitution Models, Introgression and Migration Models, and Isolation with Migration Models. Control files illustrating the 4 methods of analysis A00, A01, A10 and A11 are found in Methods of Analysis. The content of the control file A00.bpp.ctl is displayed below:

    seed =  -1

    seqfile = frogs.txt
    Imapfile = frogs.Imap.txt
    jobname = out

    # fixed species tree and delimitation
    speciesdelimitation = 0 
    speciestree = 0

    species&tree = 4  K  C  L  H
                   9  7 14  2
                   (((K, C), L), H);

    # sequence data are unphased for all 4 populations
    phase =   1  1  1  1

    # 0: no data (prior); 1:seq like
    usedata = 1  

    # number of data sets in seqfile
    nloci = 5  

    # remove sites with ambiguity data (1:yes, 0:no)?
    cleandata = 0    

    # invgamma(a, b) for theta
    thetaprior = invgamma 3 0.004 E  

    # invgamma(a, b) for root tau & Dirichlet(a) for other tau's
    tauprior = invgamma 3 0.002    

    *     heredity = 1 4 4
    *     locusrate = 1 5

    # finetune: auto-adjust step lengths during burnin
    finetune = 1

    # MCMC samples, locusrate, heredityscalars, Genetrees
    print = 1 0 0 0

    burnin = 8000

    sampfreq = 2

    nsample = 100000

A comment about comments
Optional comments may be added to the control file. If either a '#' or a '*' symbol occurs on a line, everything following the symbol up to the end of the line will be ignored by the BPP program. This allows optional comments to be added by the user either to explain choices (or meanings) of variables, or to retain optional alternative variable settings for future use. The control files presented in this documentation use the different comment-initiating symbols for distinct purposes:

  1. '#' initializes a comment that lists and/or explains the possible settings of the variable found immediately below the comment.

  2. '*' initializes a comment that retains deactivated variable settings (for future use). If an alternative to a defined variable it follows that variable.

It is good practice to make use of these conventions for comments in your own bpp control files.

Control file variables explained

Here we walk through the variables in the above control file example explaining the meaning of each and the valid values that can be specified. An exhaustive description of all control file variables and permissible values is given in Control File.

    seed = -1

This line specifies the seed value used to initialize the random number generator. Because BPP uses pseudorandom numbers to drive a stochastic algorithm for inference the results will vary between analyses initiated with different seeds, but will be identical if the same seed is used (because pseudorandom numbers are generated using a deterministic algorithm started with the value of seed). Setting seed = -1 specifies that BPP use the clock on the computer to generate a seed. With this setting, every run of the program will automatically be started with a different seed. The seed that was used for a run is stored in a file generated by the program called SeedUsed.

    seqfile = frogs.txt
    Imapfile = frogs.Imap.txt
    jobname = out

These lines specify the names of the files used to run the program and summarize the output. The program will assume that all these files are located in the current working directory since no path is specified. The line seqfile = frogs.txt specifies that the sequence data are in the file named frogs.txt. See Sequence File for a description of the sequence data file format. The line Imapfile = frogs.Imap.txt specifies that the map file is named frogs.Imap.txt. See Imap File for a description of the map file format. The line jobname = out specifies that the program output and mcmc samples are printed to files named out.txt and out.mcmc.txt, respectively. The format of the output file depends on the type of analysis being performed and is described in Methods of Analysis.

    # fixed species tree
    speciesdelimitation = 0 
    speciestree = 0

The line speciesdelimitation = 0 specifies that the number of species is fixed (not delimited) and the line speciestree = 0 specifies that the species phylogeny (topology) is fixed (not estimated). This combination specifies an analysis of type A00, which is parameter estimation under a MSC using multiple-loci and multiple-species data on a fixed species tree (Rannala and Yang 2003; Burgess and Yang 2008). Analysis A00 is described in detail in A00: Demography and Divergence Time Estimation.

    species&tree = 4  K  C  L  H
                   9  7 14  2
                   (((K, C), L), H);

The line species&tree = 4 K C L H specifies the number of species/populations and their names. This example specifies 4 species in the data, which are K, C, L and H. The next line 9 7 14 2 specifies the maximum number of sequences at any locus for each species/population (in the same order as the species listing on the previous line). This example specifies a maximum of 9 sequences for K, 7 for C, 14 for L and 2 for H. The program interprets these numbers as follows. First, if the number of sequences for a species is 2 or greater, \theta for that species will be a parameter estimated by the program. Second, the sum of the numbers of sequences over all species specifies the maximum number of sequences at a locus. However, specifying 2 sequences for a species when there are actually 10 sequences for that species at some loci in the data file has no harmful effects. Note that if there are s species in the species tree, the model will minimally contain the following parameters: s 1 species divergence times (\tau$s) and $s 1 ancestral species \theta$s. A \theta$ parameter will also exist for each contemporary species with at least two sequences present at some locus. If the data are for a single species/population, the model will contain one parameter only, \theta for that species.

The line (((K, C), L), H); specifies the (fixed) species tree in Newick format ending with a semicolon (;). This example specifies a tree with no introgression (the MSC model). Specification of the MSC-I model with introgression is different (see Introgression and Migration Models for a description of the MSC-I model). The Newick and extended Newick formats for specifying phylogenetic trees are described in Introgression and Migration Models and a good overview is found at https://en.wikipedia.org/wiki/Newick_format.

    # sequence data are unphased for all 4 populations
    phase =   1  1  1  1

The phase variable is specified using a boolean (0/1) indicator variable for each species/population, with 0 (the default) specifying that sequences from that species are fully phased haplotypes and 1 specifying they are unphased diploid sequences. If this line is omitted, all sequences are assumed to be fully phased (that is, value 0 for all species). The program does not allow some sequences from a species to be phased while other sequences from that same species are unphased. If the variable is 1, each sequence from that species is treated as an unphased diploid sequence, with heterozygous sites represented using ambiguity characters YRMKSW. The chararcters N, - and ? are allowed in the sequence file and are all treated as ?, but other ambiguities (HBVD) are not allowed. Each sequence is then expanded/resolved into two sequences, and the program averages over all the possible phase resolutions according to the approach of Gronau et al 2011. For example a sequence with two heterozygous sites R and Y is resolved into two possible haplotypes: (i) A...T and G...C, and (ii) A...C and G...T. Note that this option forces a sequence with no heterozygote sites to be phased/resolved into two identical sequences.

The MSC model averages over different phase resolutions of the heterozygote sites in the likelihood calculation. This option may increase the memory usage and CPU time considerably if there are many sequences with many heterozygote sites at one locus. The simulation program MCcoal has been modified to simulate diploid unphased data as well. This allows one to use simulations to examine the difference between the analysis of the full data and the unphased data. If the phase flag for a species is 0, all sequences from that species are treated as resolved haplotype sequences, and ambiguities are interpreted in the usual way (for example, Y means one nucleotide that is either T or C).

    # 0: no data (prior); 1:seq like
    usedata = 1  

The line usedata = 1 specifies that the likelihood is used in the MCMC run to generate the posterior distribution of parameters. Setting this to 0 allows one to run the MCMC without sequence data to generate the prior (mostly used for debugging).

    # number of data sets in seqfile
    nloci = 5  

The line nloci = 5 specifies the number of loci (alignments) to be 5. There may be more loci in the sequence data file than is specified here. For example, if 200 loci exist in the sequence data file and you specify nloci = 2 in the control file, BPP will read the first two loci only.

    # remove sites with ambiguity data (1:yes, 0:no)?
    cleandata = 0    

The line cleandata = 0 specifies that columns in the alignment which have gaps or ambiguity characters are retained and used in the likelihood calculation. Setting cleandata = 1 instead specifies that such data are removed prior to analysis.

    # invgamma(a, b) for theta
    thetaprior = invgamma 3 0.004 E  

The line thetaprior = 3 0.004 E specifies the inverse-gamma prior IG(\alpha, \beta) for the \theta parameters, with the mean to be \beta/(\alpha-1). In the example, the mean is 0.004/(3 1) = 0.002 (two substitutions per kb on average) and the option E specifies that the program analytically integrates over $\theta$s. Note that all \theta parameters in the MSC model (for both modern species and extinct ancestral species) are assigned the inverse-gamma prior with the same parameters.

Analytical integration of \theta and the inverse gamma prior
The inverse-gamma is a conjugate prior for \theta (Hey and Nielsen 2007) which means that both the prior and the posterior of \theta will be inverse-gamma. Use of the conjugate priors allows the \theta parameters to be integrated out analytically, and thus the dimension of the parameter space is reduced. This typically leads to improved mixing of the MCMC. However, with this option, the posterior of the \theta parameters will not be produced. To estimate the \theta parameters, add the letter e (or E) on the line, as follows

    thetaprior = invgamma 3 0.002 e

Whether $\theta$s are integrated out or estimated, other results (such as the posterior of the \theta parameters or the posterior probability of species trees or species-delimitation models) should be identical. A useful strategy may be to run the A01, A10, and A11 analyses without estimating the \theta parameters, and after the MAP model (the best species tree or the best species delimitation model) is identified, run the A00 analysis with the model fixed to estimate all parameters.

Some notes about the inverse-gamma distribution. Since BPP3.4, both the \theta and \tau parameters are assigned the inverse gamma priors rather than the gamma priors in version 3.3 or earlier. One difference is that the gamma is light-tailed while the inverse-gamma is heavy-tailed, so that the inverse-gamma may be less influential than the gamma if your prior mean is much too small. The inverse-gamma distribution IG(\alpha, \beta) has mean m = \alpha/(\beta-1) if \alpha > 1 and variance s^2 = \beta^2/[(\alpha-1)^2(\alpha-2)] if \alpha > 2, while the coefficient of variation is s/m = \sqrt{1/(\alpha-2)}. If little information is available about the parameters, you can use \alpha = 3 for a diffuse prior and then adjust the \beta so that the mean looks reasonable. For example, for the human species, \theta_H \approx 0.0006, which means that two random sequences from the human population are different at  0.06% of sites, less than 1 difference per kb. A sensible diffuse prior is then thetaprior = 3 0.002, with mean 0.002/(3 1) = 0.001.

    # invgamma(a, b) for root tau & Dirichlet(a) for other tau's
    tauprior = invgamma 3 0.002    

The line tauprior = 3 0.002 specifies the inverse-gamma prior IG(\alpha, \beta) for \tau_0, the divergence time parameter for the root in the species tree. Other divergence times are generated from the uniform Dirichlet distribution (Yang and Rannala 2010, eq.2). In the example, the mean is 0.002/(3 1) = 0.001 (which means 0.1% average sequence divergence between the root of the species tree and the present time). If the mutation rate is 10^{9} mutations/site/year, this distance will translate to a divergence time of 1 MY.

    # finetune: auto-adjust step lengths during burnin
    finetune = 1  

The line finetune = 1 enables automatic optimization of step lengths during burnin. This is the recommended setting. The program will adjust step lengths to achieve good mixing. If auto-tuning is enabled, burnin must be > 200. For custom step lengths, use the key:value format (see section 5).

    # MCMC samples, locusrate, heredityscalars, Genetrees
    print = 1 0 0 0   

    burnin = 8000

    sampfreq = 2

    nsample = 100000

The line print = 1 0 0 0 specifies the information that is printed out during the MCMC run. It has several boolean variables (0 for off and 1 for on) that control the printouts during the MCMC. The first variable specifies whether the MCMC samples are written into the main sample file (out.mcmc.txt). The second flag is for locus-specific rate parameters (rate \mu_i, variance parameter \nu_i and species-tree branch rates for locus r_{ij}). The third flag is for locus-specific heredity scalars if those are estimated from the data. The fourth flag is for printing locus-specific gene trees. The fifth flag is for printing locus-specific substitution-rate parameters (qmat for the Q matrix, freqs for base frequencies, and alpha for gamma rates for sites).

MCMC samples are taken after the burnin (8000 iterations), and in this example, are taken every 2 iterations, with a total of 100,000 samples taken. The total number of MCMC iterations is burnin + sampfreq \times nsample. The resulting file can be large. For analysis A00 (speciesdelimitation = 0, speciestree = 0), this file can be analysed using the R package or tracer. For other analyses (A01, A10, and A11), the dimension of the sample is changing and cannot be analysed using such traceplot programs.

Combining results from different runs
The variable setting print = -1 specifies that BPP will not perform an MCMC analysis and will instead read an existing MCMC sample file and summarize the results. Thus, with setting print = 1, the out.mcmc.txt file receives the MCMC program output, but with print = -1, it instead provides the program input. When using this option be careful not to overwrite files that you intended to keep. The print = -1 option is useful for combining MCMC samples from multiple runs to produce the posterior summary. Suppose you run the same analysis 3 times in different directories -- you can merge the out.mcmc.txt files from the three runs into one file and run the program using the print = -1 option to summarize the posterior for the combined sample. Note that if you forced one or more of the jobs to terminate (using the Unix kill command for example) the last line of each out.mcmc.txt file may incomplete. If that is the case, you should delete the incomplete line. The header lines of any files being concatenated should also be deleted. Do not combine the MCMC samples from different types of analyses (i.e., using different data files and/or variable settings or priors).

Substitution Models

BPP includes several models that allow more realistic representations of the processes underlying the evolution of DNA and amino acid sequences. Fundamental to all molecular phylogeographic analyses is the model of the nucleotide or amino acid substitution process itself. DNA substitution models can accomodate different rates of substitution between nucleotides due to factors such as transition versus transversion bias and unequal stationary nucleotide frequencies. BPP allows the use of many different DNA base substitution and amino acid substitution models. For DNA sequences, the models range from a simple Jukes-Cantor model (computationally efficient) to a sophisticated General Time-Reversible (GTR) model (computationally expensive but more realistic). For closely related species the Jukes-Cantor model is often adequate, while the GTR often performs better for more distantly related species. The remaining DNA substitution models (K80, F81, HKY, T92, TN93, and F84) are all special cases (submodels) of the GTR model and are of intermediate complexity, usually having one or two free parameters (see Yang 2014). Many fixed substitution matrix models (no free parameters) for modeling substitutions among amino acid sequences are also available.

Another factor to consider is variation in overall (or average) substitution rates. The overall rate of substitution can vary in multiple ways and, based on empirical evidence, this type of variation is one of the most important factors to accommodate during phylogeographic inference. There are 3 distinct types of substitution rate variation that can be accommodated using the models implemented in BPP: rate variation among sites, rate variation among loci, and rate variation among species (or populations). Substitution rate variation among sites, or among loci, is a common pattern and is likely due to the pervasive effects of negative (purifying) selection. Variation of substitution rates among species (or populations) is more often observed among distantly related species and may reflect the effects of differential selection, evolution of DNA repair mechanisms, or other factors.

This Chapter briefly describes the models of DNA substitution, and of substitution rate variation, implemented in BPP, the parameters and priors associated with these models, and how to specify the different models in the BPP control file.

DNA Substitution Models

Jukes-Cantor model

One of the earliest and simplest models of DNA substitution, the Jukes-Cantor model, assumes that all possible changes between the 4 nucleotides have equal rates and thus the stationary frequencies of bases are 1/4 each. This model is the default in BPP and will be used if no model is specified in the control file. The control file variable model specifies the substitution model and the explicit specification of the JC69 model is:

    model = JC69

The JC69 model appears exceedingly unrealistic. However, for closely related sequences (with few multiple substitutions) it often performs as well as more sophisticated models while incurring much less computational expense. There are no parameters associated with the JC69 model (other than the substitution rate) so no additional control file variables associated with the JC69 substitution model need to be specified.

GTR model

The General Time-Reversible (GTR) model implemented in BPP allows different rates of substitution between different nucleotide pairs, with the constraint that the process is "reversible" so that, for example, the rate of transition from A to T equals the rate of transition from T to A and so on. The GTR model accommodates factors such as transition-transversion bias and should be used when sequences are more divergent (distantly related species). The control file specification of the GTR model is:

    model = GTR

Note that if the GTR model is used, two other variables may be specified in the control file: Qrates and basefreqs. The Qrates variable specifies whether the exchangeability parameters of the GTR model are fixed or variable as well as either their fixed values, or prior mean values, respectively. The control file specification is:

    Qrates = B a b c d e f

The variable B is either 0 (variable exchangeability parameters) or 1 (fixed exchangeability parameters). The variables a b c d e f are positive numbers specifying the exchangeability parameters for TC, TA, TG, CA, CG and AG substitutions respectively (see Yang 1994). Note that TC is the rate of either T->C or C->T substitutions. Note that only the relative rates matter because the rate matrix is scaled to have an overall average substitution rate of 1. Thus, for the model of fixed rates if x is any positive number a b c d e f and xa xb xc xd xe xf are equivalent specifications. An example with fixed rates is as follows:

    Qrates = 1  2 1 1 1 1 2

which specifies a=2,b=c=d=e=1,f=2 so that the transition rate is twice as high as the transversion rate, corresponding to a K80 or HKY model. In most cases, users will want to use the GTR model with exchangeability parameters variable. Using this specification, the posterior distribution of the parameters will be estimated from the data. An example with variable rates is as follows:

    Qrates = 0  10 5 5 5 5 10

The absolute magnitude of the numbers does matter in this case as it determines the variance of the prior probability distribution on exchangeability parameters. The variance is inversely proportional to the absolute magnitude of the variables. The prior on the free parameters a, b, c, d, e is a Dirichlet distribution with parameters

\alpha_a = 10, \alpha_b = \alpha_c = \alpha_d = \alpha_e = 5, \texttt{and} \, \alpha_f = 10

The rates generated from the Dirichlet sum to 1 and are rescaled. If we define

\alpha = \alpha_a + \alpha_b + \alpha_c + \alpha_d + \alpha_e + \alpha_f

then the mean for a is \alpha_a/\alpha and the variance for a is

\textrm{Var}(a) = \frac{\frac{\alpha_a}{\alpha}\left(1-\frac{\alpha_a}{\alpha}\right)}{\alpha + 1}.

The means and variances of the other parameters are the same (substituting subscripts). Thus, in this example, the mean for a is \alpha_a/\alpha = 10/40 = 1/4 and the variance is (1/4)(3/4)/41 = 4.6 \times 10^{-3}. The prior specified above has an average transition-transversion rate ratio of 2 (if base frequencies are all fixed at 1/4).

The other control file variable that must be specified when using the GTR model is the basefreqs variable which specifies whether the stationary nucleotide (base) frequencies are fixed, or variable, and either their fixed values, or relative prior means, respectively. The control file specification is:

    basefreqs = B T C A G

where B is either 0 (variable base frequencies) or 1 (fixed base frequencies) and T C A and G are numbers specifying the frequencies of bases T, C, A and G, respectively. An example with fixed base frequencies is as follows:

    basefreqs = 1  0.1 0.2 0.2 0.5

In most cases, users will want to use the variable base frequencies setting which specifies that the posterior distribution of base frequencies is estimated from the data. An example with variable base frequencies is as follows:

    0  10 10 10 10

Here the 4 variables T C A G specify the alpha parameters of a Dirichlet prior distribution on the nucleotide frequencies. So, the prior mean frequency of base A in this example is 10/40 = 1/4 and the variance is (1/4)(3/4)/41 = 4.6 \times 10^{-3}. As noted above when discussing the Dirichlet prior for exchangeability parameters the absolute magnitude of the variables determines the variance of the Dirichlet prior. If a GTR model is chosen and Qrates and basefreqs are not specified in the control file default values of Qrates = 0 1 2 1 1 2 1 and basefreqs = 0 1 1 1 1 will be used.

Other DNA substitution models

A range of models are available that fall between the JC69 model and the GTR model in terms of complexity and number of parameters. The additional models available include: K80, F81, HKY, T92, TN93, and F84. The priors on the parameters of these models are pre-specified by the program.

Amino acid substitution models

There are many amino acid substitution models available. These models completely specify the substitution matrix so there are no free parameters. Many of the models are described in Yang 2014. The available models are: DAYHOFF, LG, DCMUT, JTT, MTREV, WAG, RTREV, CPREV, VT, BLOSUM62, MTMAM, MTART, MTZOA, PMB, HIVB, HIV,W, JTTDCMUT, FLU, and STMTREV.

Custom among-locus model variation

If a single substitution model is specified, all loci are assigned that model. The control file option model = Custom filename can be used to assign different models among loci, where the models are specified in the file filename. This file should contain one or more lines with the format:

loci_indices data_type model

where loci_indices is an index or range of indexes for loci (indexed according to their order of occurrence in the sequence data file), data_type is either DNA or AA, and model specifies the substitution model variable for the indexed loci as described above. For example, the entry

1-10 DNA JC69
11 AA DAYHOFF

specifies that loci 1 to 10 comprise DNA sequences that will have the JC69 model applied to them, while locus 11 is an amino acid sequence that will have the DAYHOFF model applied to it.

Models of Substitution Rate Variation

Among-site rate variation

Substitution rates vary among sites due to many factors, including purifying selection in coding regions. BPP allows among-site rate variation to be accomodated using the canonical Gamma distributed rate variation model (see Yang 1994). In this model, the mean rate among sites is constrained to be 1 so that the expected number of substitutions on a branch is proportional to its length (in units of expected substitutions). If the mean of the Gamma distribution is fixed, the only free parameter is the shape parameter \alpha. The variance of rates among sites is 1/\alpha and therefore a smaller \alpha specifies more rate variation. Gamma distributed rate variation is specified using the control file variable alphaprior. If this variable is not set the default is \alpha = \infty so that the variance is zero (rates are constant among sites). The prior on \alpha is also a Gamma distribution with parameters \alpha_p and \beta_p. The control file specification is as follows:

alphaprior = a b ncatG

where a = \alpha_p and b = \beta_p are the parameters of the Gamma distributed prior on the parameter \alpha and ncatG is the number of rate categories used to approximate the Gamma distribution. A discrete distribution is used to efficiently approximate the Gamma distribution and ncatG is the number of rate categories used in the approximation -- more rate categories provide a better approximation but incur greater computational expense. A value for ncatG of 4 is recommended. The variance and mean of the prior on \alpha are:

$\begin{aligned} \textrm{Mean}(\alpha) & = & \frac{\alpha_p}{\beta_p}, \nonumber \ \textrm{Var}(\alpha) & = & \frac{\alpha_p}{\beta_p^2} \nonumber\end{aligned}$

As an example, the setting alphaprior = 1 1 4 specifies a prior on the shape parameter \alpha (with 4 rate categories) that has a mean and variance of 1, thus the expected variance of \alpha is also 1. This is a fairly diffuse (uninformative) prior.

Among-locus rate variation

Empirical evidence suggests that substitution rates can vary substantially among loci, probably reflecting the influences of selection. BPP incorporates a hierarchical prior to model rate variation among loci. The models implemented in BPP allow each locus to have a different substitution rate. For L loci (alignments), there are L substitution rate parameters, where \mu_i is the rate at the $i$th locus.

Prior distribution of the mean rate among loci

The mean rate across loci is

\bar{\mu} = \frac{1}{L} \sum_{i=1}^L \mu_i.

The prior distribution for the mean rate across loci \bar{\mu} is a Gamma distribution with parameters \alpha_{\bar{\mu}} and \beta_{\bar{\mu}} and mean and variance,

$\begin{aligned} \textrm{Mean}(\bar{\mu}) & = & \frac{\alpha_{\bar{\mu}}}{\beta_{\bar{\mu}}}, \nonumber \ \textrm{Var}(\bar{\mu}) & = & \frac{\alpha_{\bar{\mu}}}{\beta_{\bar{\mu}}^2}. \nonumber\end{aligned}$

If there are no fossil calibrations in the species tree, the rates should all be relative. In this case, to avoid overparameterization we suggest fixing the mean substitution rate across loci to be \bar\mu = 1. This is done by setting \alpha_{\bar{\mu}} = \beta_{\bar{\mu}} = \infty (see discussion of control file settings below), or setting both these parameters to large values such as \alpha_{\bar{\mu}} = \beta_{\bar{\mu}} = 100, in which case \bar{\mu} is nearly fixed.

Prior distribution for locus-specific rates given mean rate among loci

Conditioning on the mean rate \bar\mu, two priors are available to specify the probability distribution of locus-specific rates, \mu_i. The control file variable argument prior (see discussion of control file settings below) can take two values dir (for Gamma-Dirichlet rates for loci), and iid (for conditional i.i.d. or hierarchical prior). If prior = dir (Gamma-Dirichlet distribution of locus rates), the total rate L\bar\mu, given the mean rate (\bar\mu), is partitioned into locus rate variables , \mu_i, that are constrained to sum to L\bar\mu and have a Dirichlet distribution with concentration parameter \alpha_\mu. The model and notation follow Burgess and Yang 2008 eq.4 and Dos Reis et al 2014 eqs.3-5. If prior = iid (Conditional-i.i.d. or hierarchical prior of locus rates), the locus rates, \mu_i, are independent and identically distributed i.i.d. given the mean rate \bar\mu, so the prior distribution of \mu_i is:

\mathtt{P}(\mu_i) = \textrm{Gamma}(\alpha_{\mu_i}, \alpha_{\mu_i/\bar{\mu}}).

This model is described in Zhu et al 2015 eq.8 and implemented in [mcmctree]{.smallcaps}. In both the Gamma-Dirichlet and the Conditional i.i.d. models, the parameter \alpha_{\mu_i} is inversely related to the extent of rate variation among loci, with a large \alpha_{\mu_i} meaning similar rates among loci (less rate variation). If all loci are noncoding, the rates are probably similar, so \alpha_{\mu_I} = 10 or 20 may be reasonable, while for coding loci or exons, \alpha_{\mu_i} = 2 or 1 may be appropriate. The \alpha_{\mu_i} parameter may affect the estimates of the population size parameter (\theta) for the root node on the species tree (Burgess and Yang 2008). The L locus rates (\mu_i) are parameters in the model. If \alpha_{\bar{\mu}} > 0, the mean rate, \bar\mu, is a parameter as well.

Control file settings for locusrate

The locusrate variable takes from 1 and 5 arguments. In the case of 5 arguments the form is shown below, with the last argument (prior) being optional.

locusrate = rate_variation a_mubar b_mubar a_mui prior 

The rate_variation variable is either 0 (no rate variation, the default), 1 (rate variation with rates inferred) or 2 (rate variation with fixed user-specified rates). If rate_variation = 0 no other variables are specified, if rate_variation = 2 then a second argument specifies the name of a file containing L specified fixed rates, one for each locus. If rate_variation = 1 the additonal variables a_mubar and b_mubar specify the shape and rate parameters (\alpha_{\bar{\mu}} and \beta_{\bar{\mu}}) of the gamma distribution that is the prior for the mean rate across loci (mubar or \bar\mu), and variable a_mui (\alpha_{\mu_i}) and prior are used to specify parameter of the prior on the locus rates (\mu_i) given the mean rate (\bar\mu) and the form of that prior (dir or iid). Some example configuration file settings are:

#  (0: No rate variation among loci.  This is default)
locusrate = 0
# (1: estimate locus rates mui)
locusrate = 1 10 10 5.0 iid
# (1: estimate locus rates mui)
locusrate = 1  0  0 5.0 iid
# (2: locus rates from file)
locusrate = 2 LocusRateFileName    

Note that locusrate = 2 LocusRateFileName specifies the fixed-rates model of locus-rate variation (Burgess and Yang 2008). This is the strategy used by Yang 2002, with the relative rates estimated by the distance to an outgroup species. The relative locus rates are listed in the file: there should be as many numbers in the file, separately by spaces or line returns, as the number of loci (nloci). The program re-scales those rates so that the average across all loci is 1 and then use those relative rates as fixed constants. The following example nearly fixes (first line), or fixes (second line) the mean rate \bar{\mu}. This is the recommended practice when no fossil calibrations are available:

# locusrate = 1 a_mubar b_mubar a_mui <prior>
# (1: estimate locus rates mui)
locusrate = 1 10 10 5 iid
# (1: estimate locus rates mui, mubar=1 fixed)
locusrate = 1  0  0 5 iid      

Note that a_mubar = 0 and b_mubar = 0 (with 0 meaning \infty) cause the program to fix \bar{\mu}, while equal and large values such as a_mubar = 100 and b_mubar = 100 cause cause \bar\mu to be nearly fixed at 1.

The locus-rate prior in IMa. The model of variable rates among loci implemented here has some differences from a similar model implemented in the IMa program Hey and Nielsen 2004. The biggest difference appears to be the parameterization. BPP defines mutation rate on a per-nucleotide basis, so the prior specifies that the expectation of the mutation rate per site is constant among loci. IMa defines mutation rate on a per-locus basis, so its prior specifies that the expectation of the mutation rate per locus is the same among loci. If locus one has 100 sites and locus two has 1000 sites, then IMa assumes that the per-site rate for locus one is 10 times for locus two, while BPP assumes the same per-site rate. Also IMa constrains the geometric mean of rates across loci to be one, while BPP constrains their arithmetic mean to be one.

Among-species rate variation

The strict molecular clock model of evolution assumes that rates of substitution for a particular gene, or genomic region, are the same in different species. Early applications of relative rates tests suggested that this assumption is often violated in empirical data, probably due to factors such as selection and in more distantly related species evolving DNA repair and proof-reading mechanisms.

One can allow rates of substitution to vary in an arbitrary way be inferring unrooted phylogenetic trees but this does not allow species divergence times to be estimated. Relaxed clock models allow the rate of substitution to vary among contemporary and ancestral species but with some constraints which allow species divergence times to be estimated. The BPP program implements two relaxed clock models, as well as a strict molecular clock model. The two relaxed clock models differ in terms of their assumptions about rates in ancestor and descendent species. The autocorrelated rates model assumes that descendents have rates that are correlated with the rate in the ancestor, while independent rates model assumes that the rates on each branch are iid from a common distribution. For the independents rates model, the variance of the distribution of rates among branches determines the degree of departure from a molecular clock - a low variance means that the rates are almost clocklike (vary little among branches).

Variation in the degree of departure from a molecular clock among loci

For a given set of species some loci may have rates that are highly clock-like while other loci may have much greater variation in substitution rates among species (branches of the species tree). To accomodate this, the variance of the substitution rate among species is allowed to vary among loci. The prior distribution of the average variance \bar{\nu} for all loci is

P(\bar{\nu}) = \textrm{Gamma}(\alpha_{\bar{\nu}},\beta_{\bar{\nu}}),

so that the expected average variance is \alpha_{\bar{\nu}}/\beta_{\bar{\nu}}. If this value is larger loci depart more from the molecular clock on average. Conditional on the average variance parameter \bar{\nu} the prior for the variance \nu_i at locus i can be either a Gamma-Dirichlet distribution or a Conditional i.i.d distribution (controlfile variables dir and iid, respectively). Both distributions have a parameter \alpha_{\nu_i} that determines the variance of the variance in rates across loci. The specification of the distribution of \nu_i given the mean \bar\nu follows the same procedure as the specification of the distribution of the locus-specific substitution rate \mu_i given the mean rate \bar\mu in the previous section; see notes above about the locusrate variable. Note that \alpha (control file variable a_vi) is inversely related to the variance in \nu_i: use small values of \alpha (2, 1, or 0.5) if you believe that \nu_i varies among loci (meaning that the clock nearly holds at some loci but is seriously violated at others).

Relaxed clock with i.i.d rates among branches

The independent rates model of the relaxed molecular clock assumes that for locus i each branch has a rate that is independent and identically distributed (i.i.d). The distribution has mean \mu_i specified by the locusrate model and variance \nu_i specified by the prior distribution for rates among loci discussed above. Two distributions are available: a Gamma distribution or a log-normal distribution (control file variables LN and G, respectively). Given the locus rate \mu_i (specified using the locusrate variable) and the variance \nu_i (specified using the clock variable) for locus i, the different lineages may have different rates at the locus, and those rates are independent among loci. If distribution = G (for gamma), the rate for species-tree branch j at locus i has the following gamma distribution

r_{ij} | \mu_i, \nu_i \sim G(\mu_i^2/\nu_i, \mu_i/\nu_i).

This has mean \mu_i and variance \nu_i.

Alternatively if distribution = LN (for log-normal), the rate for species-tree branch j at locus i has the following the log-normal distribution $r_{ij} | \mu_i, \nu_i \sim \mathrm{LN}(\mu_i, \nu_i),$ where \mu_i is the mean of the LN distribution and \nu_i is the variance parameter of the lognormal.

Relaxed clock with autocorrelated rates among branches

The autocorrelated-rates model (control file option clock = 3) with the log-normal distribution (LN) specifies the geometric Brownian motion model of Rannala and Yang 2007. This assigns a rate to each species-tree branch, that is, to the mid-point of the branch. Given the rate at the species-tree root (\mu_i at locus i), the rates for the two branches around the root are specified. Then given the rate for each ancestral branch, the rates for its two daughter branches are specified, by integrating over the rate at the internal node that is ancestral to the daughter branches. See figure 1 and equations 3-8 in Rannala and Yang 2007. The rates for all species-tree branches are thus assigned through a pre-order tree traversal, starting from the root moving to the tips, until all branches are visited.

If the gamma distribution (G) is instead used the model works as follows, using a similar pre-order tree traversal. First the two branches at the species-tree root have the gamma distribution with mean \mu_i (mu_i) and variance \nu_i (nu_i). Then given the rate for each ancestral branch, the rates for its two daughter branches are specified as independent gamma variables with the mean to be the rate of the parental branch and with the variance to be \nu_i. The autocorrelated relaxed clock model is only implemented for the MSC model and is not available when using the MSC-I model.

Rates vary among species tree branches
The rate-drift model specifies rates for branches on the species tree (rather than on the gene tree) for each locus, and gene-tree branches residing in the same population or species have the same rate. For example, if all sequences at a locus are from the same species and all coalescent events occur in that species (before reaching an ancestral species), all branches on the gene tree will have the same rate even if the relaxed-clock model allows rates to vary among species. In contrast, if a gene-tree branch passes several species or populations, the different segments of the branch will have different rates. In that case, the branch length on the gene tree is the sum of the lengths of those segments (with the length of each segment being the product of the rate and the time duration for the segment).

Control file settings for clock

The clock variable takes 6 arguments when using a relaxed clock as follows:

clock = clock_type a_vbar b_vbar a_vi prior dist

the argument clock_type takes on of three values: 1 (strict clock, default), 2 (relaxed clock with i.i.d rates) and 3 (relaxed clock with autocorrelated rates). In the case of the strict clock there are no additional arguments. The next two variables a_vbar and b_vbar specify the parameters (\alpha_{\bar{\nu}} and \beta_{\bar{\nu}}) of the Gamma prior specifying the average rate variance across loci (see above). The variable a_vi specifies the variance parameter of the prior on the locus specific variance, \alpha_{\nu_i} (see above). The variable prior is either iid or dir and specifies the prior on \nu_i given \bar{\nu} (see above). The variable dist is either LN or G specifying either a Gamma distribution of a log-normal distribution for the branch rates conditional on the locus rate \mu_i and among-branch variance \nu_i.

Several example control file entries for the clock variables are provided below:

    # (1: strict clock, default)
    clock = 1 
    # (2: independent-rates)
    clock = 2 10.0 100.0 5.0 iid G
    # (3: correlated-rates)
    clock = 3 10.0 100.0 5.0 iid G

The specification (clock = 2 10.0 100.0 5.0 iid G) means the following. First \bar\nu is assigned a gamma distribution G(10.0, 100.0), with mean 0.1. Given \bar\nu, the conditional i.i.d. prior means that \nu_i \sim G(\alpha, \alpha/\bar\nu) with shape parameter \alpha = 5.0 (a_vi) and mean \bar\nu, for i = 1, 2, \cdots, L. As another example, the specification (clock = 2 10.0 100.0 5.0 dir LN) means that \bar\nu is assigned a gamma prior G(10.0, 100.0), and then the sum L\bar\nu is partitioned into \nu_i (for i = 1, 2, \cdots, L) according to the Dirichlet distribution (prior = dir) with concentration parameter \alpha = 5.0 (a_vi). Again large \alpha means the same extent of clock violation at different loci.

Choosing \alpha_{\bar{\nu}} and \beta_{\bar{\nu}}
A larger variance \nu_i represents a greater violation of the molecular clock at locus i. Note that \nu_i will be similar to \bar\nu, especially if \alpha_{\bar{\nu}} (a_vi) is large, and \bar\nu has prior mean \alpha_{\bar{\nu}}/\beta_{\bar{\nu}}. If (a_vbar = 10 b_vbar = 100), the prior mean will be 0.1. For the log-normal model \nu = 0.5 suggests a serious violation of the clock while \nu < 0.1 represents only a slight violation.

Introgression and Migration Models

Another important factor influencing the results of species tree inference is introgression (gene flow) between species (or populations). BPP also implements a model of episodic introgression between species or populations Flouri et al 2020 as well as a model of ongoing gene flow (MSC-M). Since version 4.1, BPP implements the MSC-I model Flouri et al 2020 and since version 4.4 it implements the MSC-M model. Currently, introgression (MSC-I) and ongoing gene flow (MSC-M) analyses can only be performed using the A00 method of analysis (fixed species tree and delimitation, see Methods of Analysis). In other words, the user has to specify the number of introgression events (or bands of gene flow), their directions, and the populations involved on a fixed species tree. The program will then estimate the parameters of the MSC-I (or MSC-M) models using MCMC. We hope to implement MCMC moves that change the MSC-I (or MSC-M) models and species tree topology in the future.

The MSC-I Model

The MSC-I model involves three types of parameters: the species divergence or hybridization times ($\tau$s), the population size parameters ($\theta$s), and the introgression probabilities ($\varphi$s). The control file must specify an extended Newick format tree with one or more introgression events as well as a prior distribution for the introgression probability \varphi. The MSC-I model is specified in the species&tree block using the extended Newick notation (Cardona et al 2008)

    species&tree = 3  A  B  C
    10 10 10
    ((A, (C)H[&phi=0.5,&tau-parent=yes])S, (H[&tau-parent=yes], B) T)R;

The rules for the extended Newick format are as follows. '(A, B)S' specifies two branches from S to A and from S to B, while '(A)H' specifies one branch from H to A. Every branch in the tree model is represented once. Each tip species occurs once. Internal nodes for speciation nodes may and may not be labeled, but hybridization nodes must be labeled. The extended Newick notation is not unique.

Each hybrid node has two parental species. Models A-C are distinguished using a meta-data variable tau-parent. The value yes means that the parental population exists and has a separate age parameter \tau, with an associated \varphi parameter, while the value no means that such parameters do not exist. For example, in model (A), \tau_S, \tau_T, \theta_{Hl} (for H-left), and \theta_{Hr} (for H-right) are all parameters; in model (B), \tau_S and \theta_{Hl} are not parameters in the model while \tau_T and \theta_{Hr} are parameters; and finally in model (C), none of those four parameters exists in the model. Model (D) specifies a bidirectional introgression event between species A and B.

MSCI-models

Four different types of MSC-I models implemented in BPP
The models are specified using the extended Newick format, as follows:

(A): ((A, (C)H[&phi=0.5,&tau-parent=yes])S, (H[&tau-parent=yes], B) T)R; 
(B): ((A, (C)H[&phi=0.5,&tau-parent=no])S, (H[&tau-parent=yes], B) T)R; 
(C): ((A, (C)H[&phi=0.5,&tau-parent=no])S, (H[&tau-parent=no], B) T)R; 
(D): ((A, (B) Y[&phi=0.3])X, (X[&phi=0.1])Y)R; 
(D): ((A, (B)Y)X, (X)Y)R; 
(D): ((A, Y)X, (B, X)Y) R; 
(D): ((A, y)x, (B, x) y) r;

The control file variable phiprior specifies the prior probability for the \varphi parameter, which is a beta distribution with parameters a and b. The syntax is

    phiprior = a b

where a and b are positive numbers. For example, phiprior = 1 1 specifies the beta prior beta(a, b) with a = 1 and b = 1 for \varphi, the introgression probability under the MSC-I model.

Autogeneration of extended newick graphs

Starting with BPP release 4.4.0, we have changed the definition of introgression probability (\varphi) so that it is assigned to the horizontal (introgression) branch. This note illustrates the msci-create feature in bpp, which generates extended Newick notation for the MSC-I model from a data file which contains a binary species tree with introgression events specified using source and target branches on the tree. The --msci-create option has been available since BPP 4.2.1. The user prepares a input file (named msci.txt in our example), which includes a binary species tree in Newick format and specifies the introgression events by identifying the source and target branches involved in the introgression. Run bpp using the following command:

$ bpp --msci-create msci.txt

This generates extended Newick notation for the MSC-I model, which can be copied into a bpp control file. The input file msci.txt uses four commands: tree, define, hybridization, and bidirection.

  • tree defines the binary species tree, in Newick format.
  • define defines an ancestral species or internal node label, as the most recent common ancestor of the tip species. Alternatively you can label the internal nodes on the Newick tree.
  • hybridization defines a hybridization/introgression event by specifying the source and target branches (which represent the source and target populations involved).
  • bidirection defines a bidirectional introgression (BDI) event.

One may think of the binary species tree as describing the history of species divergences and add introgression events onto it as new (horizontal) branches. The introgression probability is assigned to the newly created introgression branch.

Examples using --msci-create

A series of examples follow. The introgression graph is displayed in a figure followed by the msci=create encoding and the resulting extended Newick format. Fig-MSCI2

# Model A, version 1
tree (A,(B,C));
define T as B,C
define R as A,B
hybridization R A, T C as S H tau=yes, yes phi=0.10

# Model A, version 2
tree (A,(B,C)T)R;
hybridization R A, T C as S H tau=yes, yes phi=0.10

# The generated Newick notation for model A is 
# ((H[&phi=0.1,tau-parent=yes],A)S, (B,(C)H[&phi=0.9,tau-parent=yes])T)R;

# Model B1
tree (A,(B,C)T)R;
hybridization R A, T C as S H tau=no, yes phi=0.10

# The generated Newick notation for model B1 is 
# ((H[&phi=0.1,tau-parent=no],A)S, (B,(C)H[&phi=0.9,tau-parent=yes])T)R;

# Model B2
tree ((A,C)S,B)R;
hybridization R B, S C as T H tau=no, yes phi=0.10

# The generated Newick notation for model B2 is 
# ((A,(C)H[&phi=0.9,tau-parent=yes])S, (H[&phi=0.1,tau-parent=no],B)T)R;

# Model C
tree (A,(B,C)T)R;
hybridization R A, T C as S H tau=no, no phi=0.40

# The generated the Newick notation for model C is 
# ((H[&phi=0.4,tau-parent=no],A)S, (B,(C)H[&phi=0.6,tau-parent=no])T)R;

# Model D
tree (A,B)R;
bidirection  A R, B R as X Y phi=0.1,0.2

The above figure illustrates the specifications of models A, B, C, and D of Flouri et al 2020. In models A, B1, and C, the introgression event is from the source branch RA to the target branch TC, with a new introgression branch SH created. The introgression probability (\varphi = 0.1) is assigned to the newly added introgression branch (SH) while 1 \varphi is assigned to the other parent branch (TH). Models A, B1, and C are distinguished by using the keyword tau (which means the same as tau-parent in the Newick notation of the MSC-I model). Model A assumes that the two parental species S and T of the hybridization node H have distinct ages from H, with \tau_S > \tau_H and \tau_T > \tau_H. Thus we have hybridization R A, T C as S H tau=yes, yes phi=0.10: the first yes means that parental node S on the source branch RA has a distinct tau from node H and that the second yes means that parental node T on the target branch TC has a distinct tau from node H. Note that there are often multiple ways of specifying the same MSC-I model and here you can specify model A by starting with the binary tree ((A, C), B) and adding branch TH as a introgression event. Model A might appear to be nonsensical biologically since only contemporary species can exchange migrants. Nevertheless, model A may be used to represent introgressions from a ghost species not sampled in the sequence dataset. Suppose at time \tau_S a speciation event generated two species SA and SH, and at \tau_H, species SH contributed migrants into species THC, but species SH has since become extinct or is otherwise not sampled in the data. This scenario matches model A. Model B1 assumes \tau_S = \tau_H and \tau_T > \tau_H so there is no new tau for parent S of the hybridization node H, and there is a new tau for parent T. Thus we have tau=no, yes. Model B2 works similarly. In model C, none of parents S and T has a distinct age from H, so we have tau=no, no. One interpretation is that species C is a hybrid species. In model D for the bidirectional introgression (BDI) model, there is no distinction of source and target branches. We specify two phi values, assigned to the introgression (horizontal) branches: \varphi_X = 0.1 for node X (or into node X) and \varphi_Y = 0.2 for node Y (see above figure).

The MSC-M Model

The multispecies-coalescent-with-migration model (or isolation-with-migration or IM model) is activated in BPP using the keyword migration. A binary species tree is specified using an extended Newick format that includes labels for internal nodes; these are subsequently used in the control file to specify the source and target populations involved in migration.

Control file specification of MSC-M

The basic model is specified in the control file as follows, using a species tree for four species (A, B, C, D) as an example:

      ((A, B)S, (C, D)T)R;

     wprior = 2 200
    migration = 2
                A C
                S C

Here S is the AB common ancestor, T is the CD common ancestor, while R is the ABCD ancestor. Not all internal nodes need to be labeled but those involved in migration have to be. The migration line specifies 2 migration connections: one connecting source population A to target population C, and another connecting source population S to target population C, with migration rates w_{AC} and w_{SC}.

!!! warning "Version 4.8.0 Breaking Change" The option migprior has been replaced by wprior with a different parameterization. If you are upgrading from v4.7.x or earlier, you must update your control files.

BPP now uses the mutation-scaled migration rate w, defined as:

w_{XY} = m_{XY}/\mu

where m_{XY} is the proportion of immigrants in the recipient population Y from the donor population X every generation. Previous versions (4.7.x and earlier) used the population migration rate M_{XY} = m_{XY} \cdot N_Y, which represents the expected number of migrants from X to Y per generation.

Converting from old to new parameterization:

w_{XY} = 4 M_{XY} / \theta_Y and M_{XY} = \theta_Y \cdot w_{XY} / 4

See Appendix A for definitions of migration rates used in different programs.

Prior on migration rates

The control file variable wprior = alpha beta specifies a default gamma prior density with parameters alpha and beta for all migration rates. In the example above, both w_{AC} and w_{SC} are assigned the gamma prior G(2, 200), with prior mean 2/200 = 0.01. A separate gamma prior can instead be defined for each migration rate (where the migration connection is specified using the source and target populations) and this specification takes precedence. For example if we specify

     wprior = 2 200
    migration = 2
                A C  2 100
                S C

the priors are w_{AC} \sim G(2, 100) with the prior mean 0.02 and w_{SC} \sim G(2, 200) from the default prior specified by wprior.

Variable migration rates among loci

In this model, the migration rate w_i at each locus i varies according to a gamma distribution w_i \approx G(\alpha_w,\alpha_w/\overline{w}), with shape parameter \alpha_w while the mean rate \overline{w} is assigned the gamma prior \overline{w} \approx G(\alpha,\beta). Here \alpha_w is a parameter that characterizes the variation of w_i among loci, with a small \alpha_w (e.g., 0.5 or 1) indicating highly variable rates among loci and a large \alpha_w indicating nearly constant migration rates among loci (when \alpha_w = \infty all loci have the same rate).

     wprior = 2 200
    migration = 2
                A C  2 100 5
                S C

In the above example, w_{SC} is applied to all loci with the prior G(2, 200), but w_{AC} varies among loci according to the shape parameter \alpha_w = 5, and the mean rate for all loci \overline{w}_{AC} is assigned the gamma prior G(2, 100).

Priors and pseudo-priors

When the gene flow involves ancestral species, migration may become impossible because of changes to the species divergence times in the MCMC. In the example above, if \tau_S < \tau_T migration from S to C is possible during the time period (\tau_S, \tau_T), but if \tau_S > \tau_T migration from S to C is impossible as the two populations were never contemporary. Thus the MCMC proposal to change species divergence times \tau_S or \tau_T may cause the migration rate parameter w_{SC} to disappear or reappear. When w_{SC} is absent from the model (that is, when \tau_S > \tau_T), the MCMC algorithm treats it as a pseudo-parameter (written as w^*_{SC}) and assigns it a pseudo-prior to facilitate the trans-dimensional move. The choice of pseudo-priors affects the mixing efficiency of the MCMC, but not the correctness of the algorithm. For good mixing, one should choose the pseudo-prior to be close to the posterior of the parameter w_{SC} (which can be generated by running short chains).

     wprior = 2 200
    migration = 2
                A C  2 100
                S C  2 200   100 250

In the example above, the prior w_{SC} \approx G(2, 200) is applied when \tau_S < \tau_T, and the pseudo-prior w^*_{SC} \approx G(100, 250) with mean 0.4, is applied when \tau_S > \tau_T. Note that in this example the pseudo-prior is far more concentrated than the prior (with shape parameter 100 versus 2). In order to summarize the posterior from the MCMC samples, only those samples taken when the migration rate is defined should be used (that is, only samples collected when \tau_S < \tau_T in our example). Samples collected when the migration rate does not exist in the model (that is, when \tau_S > \tau_T in our example) approximate the pseudo-prior.

In the case of four species, the following awk commands may be used to split the samples into two files (this assumes that tau_S and tau_T are in column 10 and 11)

awk 'BEGIN {cnt=0} NR>1{if ($10 > $11) {cnt=cnt+1;}}} END {print cnt}' out.mcmc.txt
# split sample file into ab.txt (samples where t_AB > t_CD) and cd.txt (t_CD > t_AB)
head -n 1 out.mcmc.txt > cd.txt; awk 'NR>1 {if ($10<$11) print $0}' out.mcmc.txt >> cd.txt
head -n 1 out.mcmc.txt > ab.txt; awk 'NR>1 {if ($10>$11) print $0}' out.mcmc.txt >> ab.txt

Use something like this if you understand the syntax. The running mean of the migration rate printed on the monitor during the MCMC run is the posterior mean after the filtering. Note that this problem of the migration rate appearing and disappearing during the MCMC may exist when a migration event involves ancestral populations, and is not limited to the balanced species tree for four species. Later we should automate the summary of the MCMC sample. Under the model of variable w among loci, all migration rates for all loci may appear and disappear if the migration involves ancestral species. The following six ways of specifying the model and priors and pseudo-priors are accepted (with w_{SC} as an example)

(a)  S C
(b)  S C a_w
(c)  S C a b
(d)  S C a b a_w
(e)  S C a b pseudo_a pseudo_b
(f)  S C a b a_w pseudo_a pseudo_b

In options (a) and (b), the default prior specified with wprior is assigned on w_{SC}.

Combined Analyses of Organelle Genomes and Sex Chromosomes

When performing a combined analysis of data from autosomal, mitochondrial, chloroplast or sex chromosomes one needs to account for the differences of effective population sizes between loci from these different sources. This can be done using a heredity multiplier (referred to as an inheritance scalar by Hey and Nielsen 2004). The heredity variable in the BPP control file allows for such differences. Here are some examples:

    heredity = 0       # (0: No variation)
    heredity = 1 4 4   # (1: estimate, & a_gamma b_gamma)
    heredity = 2 heredity.txt      # (2: from file)

The specification heredity = 0 is the default and means that \theta is the same for all loci. heredity = 1 or 2 specifies two models that allow \theta to vary among loci, which may be useful for combined analysis of data from autosomal, mitochondrial, X and Y loci. With such mixed data, the effective population sizes are different among loci, so that a heredity multiplier (Hey and Nielsen 2004) should be applied. Other factors such as natural selection may also cause \theta to deviate from the neutral expectation. BPP implements two options for this. The first option (heredity = 1) is to estimate the multipliers from the data, using a gamma prior with parameters \alpha and \beta specified by the user. In the example above, a gamma prior G(4, 4), with mean 4/4 = 1, is specified for the multiplier for each locus. The MCMC should then generate a posterior for the multiplier for each locus. The second option (heredity = 2) is for the user to specify the multipliers in a file, and the multipliers will then be used as fixed constants in the MCMC run. The file simply contains as many numerical values as the number of loci, separated by spaces or line breaks.

Genome Heredity scalar
Autosome 1
X chromosome 0.75
Y chromosome 0.25
Mitochondrial 0.25

Table. Examples of Common Heredity Scalars

Note.--- The effect of the locus-specific mutation rates and the locus-specific heredity multipliers are different. A locus rate is used to multiply all \theta$s and \tau$s for the locus, while a heredity multiplier is used to multiply all \theta parameters for the locus but not the $\tau$s. Nevertheless, those parameters are quite likely to be strongly correlated, especially when the species tree is small.

Methods of Analysis

Here we describe the specifics of the four different types of analyses that BPP can perform and illustrate them using several of the example control files provided in the examples subdirectory of the BPP distribution. Briefly, BPP is capable of analyzing sequence data using 4 distinct phylogeographical models. The 4 models are determined by the combinations of two possible settings for each of the two Boolean control file variables speciesdelimitation (0 = no species delimitation, 1 = species delimitation) and speciestree (0 = fixed species tree, 1 = inferred species tree). Therefore, analysis A00 infers the biogeographical parameters \theta and \tau on a fixed (user specified) tree with a fixed (delimited) number of species/populations as described in (Rannala and Yang 2003. Analysis A10 delimits the number of species and infers biogeographical parameters using a fixed species tree (guide tree) as described in Yang and Rannala 2010. Analysis A01 infers the species tree and biogeographical parameters using a fixed number of species (delimitation) as described in Rannala and Yang 2017. Analysis A11 jointly infers the species tree, species delimitation and biogeographical parameters as described in Yang and Rannala 2014. Under Model A00 it is also possible to include a model of either instantaneous introgression or ongoing gene flow -- examples of such analyses are given in Introgression and Migration Models. For each of these 4 major types of analyses the control file specifications will differ as well as the form of output printed to the screen and output files. Therefore, we will include two subsections in our discussion of each analysis method: input and output. Here we only consider the control file variables specific to the methods of analysis under consideration. For a general discussion of other control file variables see the example control file discussed in Control File. Note that for most analyses the output printed to screen during the run and that printed to the specified output file will be identical.

It is important to note that only analysis A00 applies within-model inference. There is one specified model in that case (the MSC with a fixed species tree) and the parameters are well defined, with the objective being to estimate those parameters. In contrast, analyses A01, A10, and A11 all apply trans-model inference. They move between different models, and the main objective is to calculate the posterior probabilities of the models. Each is an instance of the MSC model, but the species delimitation (the number and nature of the species) and/or the species phylogeny may differ between models. In analyses A01, A10, and A11, the prior specified using control file variable thetaprior applies to all \theta parameters in all models. Similarly, all MSC models specifying two or more delimited species have a parameter \tau_0 (the divergence time of the root), and these parameters (for different models) are assigned the same prior, specified by the tauprior control file variable.

A00: Demography and Divergence Time Estimation

Analysis A00(speciesdelimitation = 0, speciestree = 0), requires a user-specified species tree topology, given by variable species&tree in the control file, and infers the \theta and \tau parameters on this fixed tree. The theory underlying estimation of species divergence times and population sizes (\tau$s and \theta$s) under the MSC model when the species phylogeny is given is described in (Rannala and Yang 2003. Note that if there are s species in the species tree, the model will minimally contain the following parameters: s 1 species divergence times (\tau$s) and $s 1 ancestral species \theta$s. A \theta$ parameter will also exist for each contemporary species with at least two sequences present at some locus. If the data are for a single species/population, the model will contain one parameter only, \theta for that species. If there is only one species, the MSC model becomes the single-population Kingman coalescent. We will provide examples of both a single population analysis (using the control file yu2001.bpp.ctl) and a multi-species analysis (using the control file A00.bpp.ctl).

How many \theta and \tau parameters exist?
The number of parameters that BPP includes in the MSC or MSC-I/MSC-M models depends on the data configuration. The program always includes \theta and \tau parameters for each internal node (ancestral species) on the species tree, but includes a \theta for an extant species (tip) if and only if that species has at least 2 sequences at some loci. If two or more sequences for a species are specified in the control file but there are at most 0 or 1 sequence per locus for that species in the sequence data file, \theta for that species will not be identifiable or estimable. In that case, the posterior for the parameter will be the prior. Nevertheless, other results (such as the posterior distribution for other parameters or posterior probabilities for species trees and species delimitations) will still be correct. The same applies to other more complex cases of missing data and parameter non-identifiability. As an example, suppose the species tree and the numbers of sequences (for species A, B, C and D from left to right) for two kinds of loci are as follows:

((A,B), (C,D))
locus configuration 1: 1 1 0 0
locus configuration 2: 2 0 0 1

In this case, \theta_A, \theta_{AB}, \theta_{ABCD}, \tau_{AB}, and \tau_{ABCD} are identifiable while \theta_B, \theta_C, \theta_D, \theta_{CD} and \tau_{CD} are not. It is impossible to estimate \theta_D , \theta_{CD} and \tau_{CD} as no data are available from species C.

Input A00 (single population)

Our first example is a dataset of human sequence data generated by Yu et al 2001. The control file is found in the BPP distribution at location:

    examples/yu2001/yu2001.bpp.ctl

The data comprise 61 phased sequences for a single locus that will be analyzed to estimate the single parameter \theta. There is no need to specify an Imap file, or tag the sequence names in the sequence file (yu2001.txt); the sequence names are read and then ignored. Multiple loci may be included in the sequence file. The contents of the control file yu2001.bpp.ctl are shown below:

    seed = -1

    seqfile = yu2001.txt
    jobname = out

    # fixed species delimitation and species tree
    speciesdelimitation = 0 
    speciestree = 0

    species&tree = 1  H
                      61  # max number of sequences

    # 0: no data (prior); 1:seq like
    usedata = 1

    # number of data sets in seqfile
    nloci = 1    

    # remove sites with ambiguity data (1:yes, 0:no)?
    cleandata = 0    

    # gamma(a, b) for theta
    thetaprior = gamma 2 2000

    # auto (0 or 1): finetune for GBtj, GBspr, theta, tau, mix, locusrate, seqerr
    finetune = 1  

    # MCMC samples, locusrate, heredityscalars, genetrees
    print = 1 0 0 0  
    burnin = 4000
    sampfreq = 2
    nsample = 10000

The two lines:

    speciesdelimitation = 0 
    speciestree = 0

specify that the species delimitation (number of species) is fixed as well as the species tree topology. In this case, there is no species tree and only a single species exists. There is no need for a species tree, so the block for specifying species names and species tree looks like this:

    species&tree = 1  H
                      61

The line:

    # gamma(a, b) for theta
    thetaprior = gamma 2 2000

specifies a gamma distribution for the prior on \theta with parameters \alpha = 2 and \beta = 2000 which has mean 0.001 and variance 5 \times 10^{-7}.

Output A00 (single population)

When BPP is run using the above control file a summary of the progress of the MCMC analysis is printed to screen. Here, we briefly explain what this output means. The different analyses presented in this chapter all produce a similar form of output when the program is running, but the number of columns and their specific content varies somewhat. Omitting some mostly irrelevant output related to the adjustment of proposal moves, the output to screen when this control file is run appears as follows:

     |    Acceptance proportions     |
Prgs | Gage Gspr  th1  thg  tau  mix | theta1       log-PG         log-L
------------------------------------------------------------------------
 -15%  0.71 0.18 0.00 0.00 0.00 0.38   0.0004    467.11472  -12721.22305  0:01
 (some output omitted here)
   5%  0.71 0.29 0.33 0.80 0.00 0.24   0.0004    428.40742  -12721.09413  0:05
  10%  0.71 0.29 0.31 0.82 0.00 0.25   0.0003    480.92848  -12720.75185  0:06
  15%  0.71 0.29 0.30 0.83 0.00 0.24   0.0003    476.37432  -12720.65199  0:08
  20%  0.71 0.29 0.31 0.84 0.00 0.23   0.0003    441.36960  -12720.92326  0:09
  25%  0.71 0.29 0.32 0.85 0.00 0.23   0.0003    443.51740  -12720.85802  0:10
  30%  0.71 0.29 0.31 0.86 0.00 0.23   0.0003    441.93616  -12720.86033  0:11
  35%  0.71 0.29 0.31 0.87 0.00 0.23   0.0003    495.50716  -12720.84565  0:12
  40%  0.71 0.29 0.31 0.88 0.00 0.23   0.0003    452.82049  -12720.87810  0:13
  45%  0.71 0.29 0.31 0.89 0.00 0.23   0.0003    461.93346  -12720.94582  0:15
  50%  0.71 0.29 0.32 0.90 0.00 0.23   0.0004    463.85955  -12721.01005  0:16
  55%  0.71 0.29 0.32 0.91 0.00 0.23   0.0004    463.42744  -12720.98006  0:17
  60%  0.71 0.29 0.32 0.92 0.00 0.23   0.0004    478.52797  -12721.03353  0:18
  65%  0.71 0.29 0.32 0.93 0.00 0.23   0.0004    499.97705  -12720.96168  0:19
  70%  0.71 0.29 0.32 0.94 0.00 0.23   0.0004    455.32489  -12720.93611  0:20
  75%  0.71 0.29 0.32 0.95 0.00 0.23   0.0004    439.21544  -12720.99190  0:22
  80%  0.71 0.29 0.32 0.96 0.00 0.23   0.0004    461.56954  -12721.00180  0:23
  85%  0.71 0.29 0.32 0.97 0.00 0.23   0.0004    469.53443  -12720.99823  0:24
  90%  0.71 0.29 0.32 0.97 0.00 0.23   0.0004    455.60303  -12720.99213  0:25
  95%  0.71 0.29 0.32 0.97 0.00 0.23   0.0004    454.07141  -12721.00745  0:26
 100%  0.71 0.29 0.32 0.97 0.00 0.23   0.0004    461.01044  -12720.97549  0:27

0:27 spent in MCMC

          theta_1H  lnL
mean      0.000352  -12720.995649
median    0.000337  -12720.726000
S.D       0.000116  2.936769
min       0.000089  -12735.535000
max       0.001293  -12712.774000
2.5%      0.000170  -12727.454000
97.5%     0.000617  -12716.086000
2.5%HPD   0.000145  -12726.920000
97.5%HPD  0.000574  -12715.718000
ESS*      757.838791  1180.434956
Eff*      0.075784  0.118043

Note that in these examples we are using a random seed from the computer clock so your results will differ slightly from those shown. The line:

     |    Acceptance proportions     |
Prgs | Gage Gspr  th1  thg  tau  mix | theta1       log-PG         log-L
------------------------------------------------------------------------

is a header that explains the content of each column printed during the run. The Prgs (progress) column will appear in all analyses and indicates the percentage of the MCMC iterations that have been completed. If this number is negative it indicates that the program is still running the burn-in iterations. For example, -15% means that 15 percent of the burn-in iterations remain to be completed. The next 6 columns are the current acceptance proportions for different parameter proposals in the MCMC. The proposals are defined as follows:

  • Gage: proposal to change ages of nodes on gene trees

  • Gspr: proposal to change gene tree topology using SPR move

  • th1: proposal to change \theta using sliding window

  • thg: proposal to change \theta using Gibbs sampler

  • tau: proposal to change \tau parameter

  • mix: mixing step proposal

In the output the acceptance proportions are stable. The tau column (the \tau proposal acceptance proportion) is zero; this is expected because there are no species divergence times ($\tau$s) in the model when only a single species exists. The column labeled theta1 gives the current average (mean) value of theta in the MCMC. The final columns are the log probability of the coalescent model (log-PG) and the log-likelihood of the sequence data on the gene tree (log-L). Check that the acceptance proportions are in a reasonable range (about 20% to 40% for continuous parameters such as \theta). If you need to terminate the program before it finishes, you can do so using the key combination Ctrl-C (e.g., hold down the Control key and then press the C key). The final screen output, printed after the MCMC is completed, summarizes the posterior parameter estimates for \theta (theta_1H) in the second column. The posterior mean in the first row, for example, is 0.000352 and the lower and upper limits of the highest posterior density (HPD) set of values are in rows 8 and 9, respectively. In this case, the HPD credibility interval for \theta is (0.000145,0.000574).

Input A00 (multiple populations)

Our second example is a dataset of frog sequence data generated by Zhou et al 2012. This same dataset will also be used to illustrate analyses A01, A10 and A11. The control file is found in the BPP distribution at location:

    examples/frogs/A00.bpp.ctl

The data comprise 5 loci for 4 populations, with the number of sequences at each locus varying between 21 and 30. We will be estimating $\theta$s for each of the 4 contemporary and 3 ancestral populations as well as the 3 species divergence times ($\tau$s). The contents of the control file A00.bpp.ctl are shown below:

    seed =  -1

    seqfile = frogs.txt
    Imapfile = frogs.Imap.txt
    jobname = out

    # fixed number of species/populations
    speciesdelimitation = 0 

    # fixed species tree
    speciestree = 0

    species&tree = 4  K  C  L  H
                        9  7 14  2
                     (((K, C), L), H);

    # unphased data for all 4 populations
    phase =   1  1  1  1

    # use sequence likelihood                  
    usedata = 1

    nloci = 5  

    # do not remove sites with ambiguity data
    cleandata = 0    

    # gamma(a, b) for theta (estimate theta)
    thetaprior = gamma 2 2000 

    # gamma(a, b) for root tau & Dirichlet(a) for other tau's
    tauprior = gamma 2 1000 

    # finetune: auto-adjust step lengths during burnin
    finetune = 1  

    # MCMCsamples, locusrate, heredityscalars, genetrees, substitutionparams
    print = 1 0 0 0

    burnin = 8000
    sampfreq = 2
    nsample = 100000

As in the previous analysis, the two lines:

    speciesdelimitation = 0 
    speciestree = 0

specify that the species delimitation (number of species) is fixed as well as the species tree topology. In this case, a species tree is specified along with population labels. The block for specifying species names and the species tree looks like this:

    species&tree = 4  K  C  L  H
                        9  7 14  2
                     (((K, C), L), H);

The first line above lists the number of species (populations) which is 4 in this example. This is followed by the label for each species (these should match the labels in the map file):

    K  C  L  H

The next line specifies the maximum number of sequences per species in the same order as the species labels:

    9  7 14  2

the actual number of sequences at any locus must be less than this value. The third line is a rooted phylogenetic tree topology specified in Newick format:

    (((K, C), L), H);

The next line specifies that the loci for each of the 4 populations are unphased:

    phase = 1 1 1 1

The specified phase variables should include a 0 or 1 (Boolean) entry for each population, where the populations are assumed to be in the same order as specified above (in the species&tree block) and the Boolean variable indicates that the sequence data for a population are either unphased (1) or phased (0). Ambiguity characters are used to represent genotypes for unphased sequences (see BPP control file variables). In the example data the sequences are unphased for all 4 populations. Currently, it is not possible to have partially phased data (e.g., only some loci unphased in a particular population). The program will infer the phase as part of the analysis.

Unlike the earlier single population analysis, in which we estimated a single \theta parameter, in the multipopulation analysis we will be estimating multiple $\theta$s (one for each population) and divergence times ($\tau$s) between populations. Thus, we have prior distributions for both \theta and \tau_0. The lines below specify a gamma distribution as the prior for \theta with parameters \alpha = 2 and \beta = 2000 (the prior mean and variance of \theta are 0.001 and 0.0000005):

    # gamma(a, b) for theta
    thetaprior = gamma 2 2000 

The lines:

    # gamma(a, b) for root tau & Dirichlet(a) for other tau's
    tauprior = gamma 1 1000 

specify a gamma distribution as a prior for the root age and the remaining $\tau$s have a uniform Dirichlet distribution conditional on the root age (the prior mean and variance of the root age are 0.001 and 0.000001,respectively):

Output A00 (multiple populations)

When BPP is run using the above control file a summary of the progress of the MCMC is again printed to screen as follows:

     |       Acceptance proportions       |
Prgs | Gage Gspr  th1  th2  thg  tau  mix | theta1 theta2 theta3    tau1   tau2   tau3      log-PG        log-L
---------------------------------------------------------------------------------------------------------------
  -3%  0.65 0.10 0.30 0.30 0.80 0.04 0.12   0.0031 0.0095 0.0068  0.0021 0.0015 0.0014   1204.63468  -4458.38814
 (some output omitted here)
   5%  0.64 0.26 0.30 0.30 0.85 0.28 0.27   0.0035 0.0096 0.0067  0.0019 0.0018 0.0017   1225.51650  -4443.85539  1:09
  10%  0.65 0.27 0.30 0.30 0.86 0.28 0.28   0.0035 0.0095 0.0068  0.0019 0.0018 0.0018   1202.62497  -4445.50020  1:47
  15%  0.64 0.27 0.30 0.30 0.87 0.28 0.28   0.0034 0.0095 0.0068  0.0019 0.0018 0.0017   1211.95125  -4446.35694  2:25
  20%  0.64 0.26 0.31 0.31 0.88 0.28 0.28   0.0034 0.0095 0.0067  0.0018 0.0018 0.0017   1211.09206  -4445.74292  3:05
  25%  0.64 0.26 0.31 0.31 0.89 0.28 0.28   0.0034 0.0096 0.0067  0.0018 0.0018 0.0017   1222.97603  -4446.12020  3:43
  30%  0.64 0.26 0.31 0.31 0.90 0.28 0.28   0.0034 0.0096 0.0067  0.0018 0.0018 0.0017   1216.60217  -4445.55424  4:21
  35%  0.64 0.26 0.31 0.31 0.91 0.28 0.28   0.0034 0.0096 0.0067  0.0018 0.0018 0.0017   1260.59722  -4445.22113  5:00
  40%  0.64 0.26 0.31 0.31 0.92 0.28 0.27   0.0034 0.0096 0.0067  0.0018 0.0018 0.0017   1269.45020  -4445.20340  5:38
  45%  0.65 0.26 0.31 0.31 0.93 0.28 0.27   0.0034 0.0096 0.0067  0.0018 0.0018 0.0017   1243.07668  -4445.00207  6:16
  50%  0.65 0.26 0.31 0.31 0.94 0.28 0.27   0.0034 0.0096 0.0067  0.0018 0.0018 0.0017   1229.59858  -4445.04036  6:55
  55%  0.64 0.26 0.31 0.31 0.95 0.28 0.27   0.0034 0.0096 0.0067  0.0018 0.0018 0.0017   1209.31273  -4445.43161  7:33
  60%  0.64 0.26 0.31 0.31 0.96 0.28 0.27   0.0034 0.0096 0.0067  0.0018 0.0018 0.0017   1206.22162  -4445.53994  8:11
  65%  0.64 0.26 0.31 0.31 0.96 0.28 0.27   0.0034 0.0096 0.0067  0.0018 0.0018 0.0017   1190.78837  -4445.21618  8:50
  70%  0.64 0.26 0.31 0.31 0.97 0.28 0.27   0.0034 0.0096 0.0067  0.0018 0.0018 0.0017   1203.82684  -4445.04124  9:30
  75%  0.64 0.26 0.31 0.31 0.97 0.28 0.27   0.0034 0.0096 0.0067  0.0018 0.0018 0.0017   1186.32176  -4445.00578  10:09
  80%  0.64 0.26 0.31 0.31 0.97 0.28 0.27   0.0034 0.0096 0.0067  0.0018 0.0018 0.0017   1222.75718  -4444.94315  10:47
  85%  0.64 0.26 0.31 0.31 0.97 0.28 0.27   0.0034 0.0096 0.0067  0.0018 0.0018 0.0017   1228.39106  -4444.68671  11:26
  90%  0.64 0.26 0.31 0.31 0.97 0.28 0.27   0.0034 0.0096 0.0067  0.0018 0.0018 0.0017   1228.72385  -4444.54844  12:04
  95%  0.64 0.26 0.31 0.31 0.97 0.28 0.27   0.0034 0.0096 0.0067  0.0018 0.0018 0.0017   1223.25921  -4444.25455  12:43
 100%  0.64 0.26 0.31 0.31 0.97 0.28 0.27   0.0034 0.0096 0.0067  0.0018 0.0018 0.0017   1199.52731  -4444.17857  13:21

13:21 spent in MCMC

              theta_1K  theta_2C  theta_3L  theta_4H  theta_5KCLH theta_6KCL theta_7KC tau_5KCLH tau_6KCL tau_7KC lnL
    mean      0.003422  0.009588  0.006683  0.003031  0.003720  0.001577  0.001648  0.001823  0.001787  0.001710  -4444.16
    median    0.003351  0.009492  0.006599  0.002932  0.003642  0.001412  0.001463  0.001809  0.001773  0.001700  -4443.69
    S.D       0.000747  0.001461  0.001118  0.000819  0.000944  0.000899  0.000954  0.000234  0.000230  0.000238  11.615936
    min       0.001309  0.004913  0.003258  0.000866  0.001131  0.000029  0.000039  0.001047  0.001043  0.000772  -4496.72
    max       0.008147  0.017569  0.012778  0.009724  0.010355  0.008461  0.008987  0.003140  0.003113  0.002847  -4403.99
    2.5%      0.002171  0.006999  0.004743  0.001729  0.002100  0.000325  0.000340  0.001404  0.001375  0.001271  -4468.01
    97.5%     0.005084  0.012720  0.009104  0.004919  0.005780  0.003751  0.003991  0.002319  0.002280  0.002209  -4422.74
    2.5%HPD   0.002071  0.006802  0.004595  0.001566  0.001949  0.000142  0.000164  0.001396  0.001342  0.001252  -4467.06
    97.5%HPD  0.004928  0.012469  0.008903  0.004650  0.005573  0.003312  0.003512  0.002308  0.002237  0.002185  -4421.90
    ESS*      2721.25   8954.56   5279.29   11762.38  1199.63   4543.27   3299.32   850.33    970.61    932.00    420.40
    Eff*      0.027213  0.089546  0.052793  0.117624  0.011996  0.045433  0.032993  0.008503  0.009706  0.009320  0.004204

There are again 5 acceptance proportions for the 5 parameter proposals, but now the current mean values of 6 parameters are printed. The current mean values of \theta for nodes 1, 2 and 3 (mthet1 mthet2 mthet3) are printed -- which are $\theta$s of the contemporary species K, C and L, and those of the 3 $\tau$s (mtau1 mtau2 mtau3) which are the divergence times for ancestral species KCLH, KCL and KC, respectively. If there are many populations/species only the first few $\tau$s will be printed to screen but all the $\tau$s will be available in the summary created at the end of the run (see below). When the run finishes, a final block is written summarizing the results. The first two rows give the mean and median of the posterior distribution for each parameter. This is followed by summaries of the statistical uncertainty: the standard deviation (S.D.) of the posterior distribution; the minimum (min) and maximum (max) values; the lower and upper bounds of the 95% Credible Interval (2.5% and 97.5%); the lower and upper bounds of the Highest Posterior Density (HPD) Interval (2.5%HPD and 97.5%HPD); the Effective Sample Size (ESS*); and the Efficiency (Eff*). Larger values for ESS* and Eff* indicate better mixing and more reliable estimates. The above information is also printed (along with other technical details of the run) to the output file specified by the jobname variable in the control file (in our example, jobname = out and thus the output file is called out.txt). A tree file in NEXUS/Newick format is also created and placed in the file named FigTree.tre which is formatted for viewing/printing using the Figtree program

MCMC output file

A file will be produced (with a name specified by the control file variable jobname) that contains the mcmc samples from the run for all the \theta and \tau parameters. When running under analysis method A00 the contents of this file can be analyzed using a program such as Tracer to visually examine the convergence and mixing of the MCMC run. However, the other three analysis methods (A01, A10 and A11) are trans-model analyses in which the number of parameters and or/the meaning of the parameters changes as the chain runs so it is not correct to examine the trace plot without conditioning on a particular model. An example of 5 lines from the out.mcmc.txt file produced by the above example are given below:

Gen	theta_1K	theta_2C	theta_3L	theta_4H	theta_5KCLH	theta_6KCL	theta_7KC	tau_5KCLH	tau_6KCL	tau_7KC	lnL
2	0.002848	0.010633	0.006000	0.002231	0.003697	0.001594	0.000704	0.001754	0.001717	0.001708	-4466.479
4	0.002848	0.011774	0.004789	0.002231	0.003697	0.002134	0.000798	0.001754	0.001717	0.001708	-4457.097
6	0.002848	0.010660	0.005826	0.002231	0.003697	0.001250	0.000799	0.001754	0.001717	0.001705	-4448.002
8	0.002848	0.012103	0.005826	0.002231	0.002615	0.001250	0.000803	0.001754	0.001717	0.001696	-4455.900

A01: Species Tree Estimation

Analysis A01 (speciedelimitation = 0, speciestree = 1) assumes that the species delimitation is fixed (e.g., species assignments are as specified in the Imap file) but that the species tree is unknown. The program estimated the species tree topology in addition to the \theta$s and \tau$s.

Input A01

Our example uses the dataset of frog sequence data generated by Zhou et al 2012 that we considered previously. The contents of the control file A01.bpp.ctl are shown below:

  seed =  -1
  seqfile = frogs.txt
  Imapfile = frogs.Imap.txt
  jobname = out

  speciesdelimitation = 0 * fixed species tree
  speciestree = 1  0.4 0.2 0.1   * speciestree pSlider ExpandRatio ShrinkRatio

  speciesmodelprior = 1  * 0: uniform LH; 1:uniform rooted trees; 2: uniformSLH; 3: uniformSRooted

  species&tree = 4  K  C  L  H
                    9  7 14  2
                 ((K, C), (L, H));
        phase =   1  1  1  1
   
  usedata = 1  * 0: no data (prior); 1:seq like
  nloci = 5  * number of data sets in seqfile

  cleandata = 0    * remove sites with ambiguity data (1:yes, 0:no)?

  thetaprior = gamma 2 2000 # gamma(a, b) for theta (estimate theta)
  tauprior = gamma 2 1000 # gamma(a, b) for root tau & Dirichlet(a) for other tau's

  finetune = 1  # finetune: auto-adjust step lengths during burnin

  print = 1 0 0 0   * MCMC samples, locusrate, heredityscalars, Genetrees
  burnin = 8000
  sampfreq = 2
  nsample = 100000

The two lines:

  speciesdelimitation = 0 * fixed species delimitation
  speciestree = 1  0.4 0.2 0.1   * speciestree pSlider ExpandRatio ShrinkRatio

now specify that the species delimitation is fixed and the species tree topology is being estimated speciestree = 1. The 3 parameters following the speciestree variable specify the probability that the snakes and ladders (SNL) move is used, rather than the subtree-pruning-regrafting (SPR) move to modify the species tree and the expand/shrink ratios for the SNL move; these proportions can be adjusted on the interval (0,1) and will affect mixing of the MCMC. For more details, see the description of the control file variable 14 speciestree. If no parameters are specified after speciestree = 1 then the SPR move is used exclusively. See Rannala and Yang 2017 for a description of the proposals available to change species trees in the MCMC. The line:

 speciesmodelprior = 1  * 0: uniform LH; 1:uniform rooted trees; 2: uniformSLH; 3: uniformSRooted

specifies the prior distribution on the species tree topologies. The specification speciesmodelprior = 1 uses a prior that gives equal probability to all rooted trees apriori. See the description of the control file variable 15 speciesmodelprior for more details. The available priors are described in Yang and Rannala 2014.

Output A01

When BPP is run using the above control file a summary of the progress of the MCMC is again printed to screen as follows:

     |            Acceptance proportions            |
Prgs | Gage Gspr  th1  th2  thg  tau  mix   Sspr   Ssnl | theta1    tau1       log-PG        log-L
--------------------------------------------------------------------------------------------------
(some output omitted here)
   5%  0.64 0.26 0.31 0.31 0.85 0.28 0.27 0.0980 0.0000   0.0037  0.0019   1213.12189  -4448.22572  1:00
  10%  0.64 0.26 0.30 0.30 0.86 0.28 0.27 0.0865 0.0000   0.0037  0.0019   1212.13271  -4447.30801  1:37
  15%  0.64 0.26 0.30 0.30 0.87 0.27 0.27 0.0885 0.0000   0.0037  0.0019   1205.76722  -4446.44035  2:20
  20%  0.64 0.26 0.30 0.30 0.88 0.27 0.27 0.0867 0.0000   0.0037  0.0019   1209.18617  -4445.20436  3:03
  25%  0.64 0.26 0.31 0.31 0.89 0.27 0.27 0.0919 0.0000   0.0038  0.0019   1189.24742  -4444.02665  3:45
  30%  0.65 0.26 0.31 0.31 0.90 0.27 0.27 0.0959 0.0000   0.0038  0.0018   1218.30083  -4443.50919  4:28
  35%  0.65 0.26 0.31 0.31 0.91 0.27 0.27 0.0908 0.0000   0.0038  0.0019   1271.24840  -4443.30946  5:13
  40%  0.65 0.26 0.31 0.31 0.92 0.27 0.27 0.0903 0.0000   0.0038  0.0018   1221.51424  -4442.93455  5:56
  45%  0.65 0.26 0.31 0.31 0.93 0.28 0.27 0.0865 0.0000   0.0037  0.0018   1179.64791  -4442.58322  6:39
  50%  0.65 0.26 0.31 0.31 0.94 0.28 0.27 0.0883 0.0000   0.0038  0.0018   1220.10587  -4442.33168  7:21
  55%  0.65 0.26 0.31 0.31 0.95 0.28 0.27 0.0882 0.0000   0.0037  0.0018   1230.47093  -4442.53042  8:03
  60%  0.65 0.26 0.31 0.31 0.96 0.28 0.27 0.0900 0.0000   0.0037  0.0019   1210.69277  -4443.13901  8:46
  65%  0.65 0.26 0.31 0.31 0.96 0.28 0.27 0.0906 0.0000   0.0037  0.0019   1259.02426  -4443.42635  9:29
  70%  0.65 0.26 0.31 0.31 0.97 0.28 0.27 0.0907 0.0000   0.0037  0.0019   1227.92007  -4443.74417  10:11
  75%  0.65 0.26 0.31 0.31 0.97 0.28 0.27 0.0907 0.0000   0.0037  0.0019   1254.82843  -4443.96093  10:55
  80%  0.65 0.26 0.31 0.31 0.97 0.28 0.27 0.0912 0.0000   0.0037  0.0019   1211.86344  -4443.93739  11:40
  85%  0.65 0.26 0.31 0.31 0.97 0.28 0.27 0.0922 0.0000   0.0037  0.0019   1205.06522  -4443.99758  12:23
  90%  0.65 0.26 0.31 0.31 0.97 0.28 0.27 0.0924 0.0000   0.0037  0.0019   1191.95318  -4444.06010  13:05
  95%  0.65 0.26 0.31 0.31 0.97 0.28 0.27 0.0918 0.0000   0.0037  0.0019   1213.34484  -4444.05286  13:47
 100%  0.65 0.26 0.31 0.31 0.97 0.28 0.27 0.0916 0.0000   0.0037  0.0019   1224.45872  -4443.84148  14:30

14:30 spent in MCMC

Species in order:
   1. K
   2. C
   3. L
   4. H

(A) Best trees in the sample (15 distinct trees in all)
    33978  0.33978  0.33978 ((C, (H, L)), K);
    17928  0.17928  0.51905 (C, ((H, L), K));
     8961  0.08961  0.60866 ((C, K), (H, L));
     8236  0.08236  0.69102 (C, ((H, K), L));
     6896  0.06896  0.75998 (((C, H), L), K);
     4548  0.04548  0.80546 (((C, L), H), K);
     4066  0.04066  0.84612 (C, (H, (K, L)));
     3037  0.03037  0.87649 ((C, (H, K)), L);
     2775  0.02775  0.90424 (((C, K), H), L);
     2245  0.02245  0.92669 (((C, H), K), L);
     2131  0.02131  0.94800 ((C, L), (H, K));
     1786  0.01786  0.96586 (((C, K), L), H);
     1423  0.01423  0.98009 (((C, L), K), H);
     1094  0.01094  0.99103 ((C, H), (K, L));
      897  0.00897  1.00000 ((C, (K, L)), H);

(B) Best splits in the sample of trees (10 splits in all)
 60867 0.608664  0011
 45422 0.454215  0111
 30230 0.302297  1011
 13522 0.135219  1100
 13404 0.134039  1001
 10235 0.102349  0101
  8102 0.081019  0110
  8057 0.080569  1101
  6057 0.060569  1010
  4106 0.041060  1110

(C) Majority-rule consensus tree
(K, C, (L, H) #0.608664);

(D) Best tree (or trees from the mastertree file) with support values
((C, (H, L) #0.608664) #0.454215, K);   [P = 0.339777]

The first part of this output are the current acceptance proportions and running means for different parameters as the MCMC was run. Columns 2 to 6 are the five acceptance proportions for the conventional MCMC moves, as discussed above. Columns 7 and 8 are the acceptance proportions for moves that change the species tree topology, both are much lower than the other parameter proposals, this is typical and it is often not possible to improve these acceptance proportions. Columns 9 and 10 are posterior means of \theta and \tau for the root population (-1 is printed in column 9 if $\theta$s are integrated out). The last two numbers are the log MSC gene-tree density (Rannala and Yang 2003) and the average log sequence likelihood (Felsenstein 1981).

Next, there are 4 sections: A, B, C and D summarizing the results. Section (A) lists the species trees in decreasing order of posterior probabilities. From this you can easily identify the 95% or 99% credibility set of species trees. Section (B) lists the splits (or bipartitions) and their posterior probabilities. The splits here take into account the location of the root, and may be different from the splits for unrooted trees. Section (C) prints the majority-rule consensus tree, with posterior probabilities for nodes.

MCMC output file

The MCMC sample of species trees is collected in the file out.mcmc.txt. Below are five lines from that file. The numbers after : are the branch lengths (\tau$s), while those after `#` are the \theta$s.

(K #0.002983: 0.001998, ((C #0.009671: 0.001684, H #0.003031: 0.001684) #0.001835: 0.000250, L #0.006266: 0.001934) #0.000560: 0.000065) #0.002770;
(K #0.003247: 0.002176, ((C #0.010528: 0.001871, H #0.004726: 0.001871) #0.002902: 0.000147, L #0.006615: 0.002017) #0.000950: 0.000158) #0.003016;
(K #0.003234: 0.002167, ((C #0.010486: 0.001843, H #0.003294: 0.001843) #0.002186: 0.000147, L #0.007822: 0.001989) #0.001087: 0.000178) #0.003003;
(K #0.002677: 0.001794, ((C #0.010973: 0.001516, H #0.001906: 0.001516) #0.001821: 0.000093, L #0.005827: 0.001609) #0.001261: 0.000185) #0.002486;
(K #0.002677: 0.001794, ((C #0.009869: 0.001516, H #0.003071: 0.001516) #0.001821: 0.000109, L #0.005788: 0.001625) #0.002495: 0.000169) #0.002486;

A10: Species Delimitation

Analysis A10 (speciedelimitation = 1, speciestree = 0) assumes that the species delimitation is unknown (e.g., population assignments as specified in the Imap file may not represent distinct species) but that the species guide tree is fixed (known). The program calculates the posterior probabilities of different possible species delimitations as well as of \theta$s and \tau$s.

Input A10

Our example uses the dataset of frog sequence data generated by Zhou et al 2012 that we considered previously. The contents of the control file A10.bpp.ctl are shown below:

	seed =  -1
	seqfile = frogs.txt
	Imapfile = frogs.Imap.txt
	jobname = out

	speciesdelimitation = 1 1 2 1 * species delimitation rjMCMC algorithm1 finetune (a m)
	speciestree = 0        * species tree NNI/SPR

	speciesmodelprior = 1  * 0: uniform LH; 1:uniform rooted trees; 2: uniformSLH; 3: uniformSRooted

	species&tree = 4  K  C  L  H
                      9  7 14  2
                 ((K, C), (L, H));
	phase =   1  1  1  1
                  
	usedata = 1  * 0: no data (prior); 1:seq like
	nloci = 1  * number of data sets in seqfile

	cleandata = 1    * remove sites with ambiguity data (1:yes, 0:no)?

	thetaprior = gamma 2 2000 # gamma(a, b) for theta (estimate theta)
	tauprior = gamma 2 1000 # gamma(a, b) for root tau & Dirichlet(a) for other tau's

	finetune = 1  # finetune: auto-adjust step lengths during burnin

	print = 1 0 0 0   * MCMC samples, locusrate, heredityscalars, Genetrees
	burnin = 8000
	sampfreq = 2
	nsample = 100000

the lines:

	speciesdelimitation = 1 1 2 1 * species delimitation rjMCMC algorithm1 finetune (a m)
	speciestree = 0        * species tree NNI/SPR

specify that the species tree is fixed speciestree = 0 (a guide tree is used as specified in the control file) and the rjMCMC algorithm 1, with \alpha = 2 and m = 1 in equations 6 and 7 of Yang and Rannala 2010 is used for species delimitation. Another possible specification for delimitation would be:

speciesdelimitation = 1 0 2

which would specify rjMCMC algorithm 0 with \epsilon = 2 in equations 3 and 4 of Yang and Rannala 2010. The two algorithms in theory should produce identical results. The line:

speciesmodelprior = 1  * 0: uniform LH; 1:uniform rooted trees; 2: uniformSLH; 3: uniformSRooted

specifies the prior distribution on topologies (see above) Prior 0 means equal probabilities for labeled histories (which are rooted trees with internal nodes ordered by their age). This is the prior used by Yang and Rannala 2010. Prior 1 means equal probabilities for rooted trees (now the default). The prior with user specified probabilities for nodes described by Rannala and Yang 2013 was removed from BPP after version 2.3. We also reduced the number of loci to 1 (nloci = 1) in this control file because otherwise species delimitation model 5 (three species) has a posterior probability of 1.

Output A10

The species delimitation models that can be generated from the fixed guide tree will be listed in the output, together with their prior probabilities calculated by BPP. (As a check, if you use usedata = 0, the MCMC should be sampling from this prior distribution.) The species delimitation model (for 4 populations as in this data set) is represented using three 0-1 flags for the three interior nodes 5, 6, 7 in the guide tree, with 0 for 'collapsed' and 1 for 'resolved'. Note that the tips in the guide tree are numbered 1, 2, \cdots, s for s potential species, while the interior (ancestral) nodes are numbered s + 1, s + 2, \cdots, 2s 1, with s + 1 to be the root of the guide tree. The numbering is through a tree-traversal algorithm, fixed by the program. This same order is used to specify the divergence time parameters ($\tau$s), so you can work out the order by looking at the list of nodes in the screen output (look at the "population by population table", "# species divergence times in the order:", etc.).

When BPP is run using the above control file a summary of the progress of the MCMC is again printed to screen as follows:

     |        Acceptance proportions         |
Prgs | Gage Gspr  th1  th2  thg  tau  mix  rj | np del        mldp theta1    tau1       log-PG        log-L
-----------------------------------------------------------------------------------------------------------
(some output omitted here)
   5%  0.62 0.25 0.30 0.30 0.85 0.33 0.29 0.0061   10 111 P[5]=0.9726 0.0026  0.0009   217.01433   -972.53408  0:08
  10%  0.63 0.25 0.30 0.30 0.86 0.34 0.29 0.0037   10 111 P[5]=0.9845 0.0026  0.0009   229.43024   -972.60186  0:12
  15%  0.63 0.25 0.30 0.30 0.87 0.34 0.29 0.0033   10 111 P[5]=0.9886 0.0026  0.0009   224.68967   -972.41862  0:16
  20%  0.63 0.25 0.30 0.30 0.88 0.34 0.29 0.0037   10 111 P[5]=0.9885 0.0026  0.0009   210.93188   -972.34981  0:21
  25%  0.63 0.25 0.30 0.30 0.89 0.33 0.29 0.0038   10 111 P[5]=0.9892 0.0026  0.0009   224.49484   -972.24813  0:26
  30%  0.63 0.25 0.30 0.30 0.90 0.33 0.28 0.0035   10 111 P[5]=0.9901 0.0026  0.0009   216.40848   -972.27563  0:30
  35%  0.63 0.25 0.30 0.30 0.91 0.33 0.28 0.0033   10 111 P[5]=0.9907 0.0026  0.0009   224.00442   -972.50421  0:35
  40%  0.63 0.25 0.30 0.30 0.92 0.33 0.28 0.0031   10 111 P[5]=0.9912 0.0026  0.0009   213.49838   -972.43257  0:40
  45%  0.63 0.25 0.30 0.30 0.93 0.33 0.29 0.0034   10 111 P[5]=0.9905 0.0026  0.0009   209.30067   -972.37969  0:45
  50%  0.63 0.25 0.30 0.30 0.94 0.33 0.29 0.0033   10 111 P[5]=0.9906 0.0026  0.0009   232.27193   -972.51538  0:50
  55%  0.63 0.25 0.30 0.30 0.95 0.33 0.29 0.0035   10 111 P[5]=0.9900 0.0026  0.0009   203.35457   -972.50992  0:55
  60%  0.63 0.25 0.30 0.30 0.96 0.33 0.29 0.0037   10 111 P[5]=0.9895 0.0026  0.0009   206.99225   -972.50202  1:00
  65%  0.63 0.25 0.30 0.30 0.96 0.33 0.28 0.0038   10 111 P[5]=0.9898 0.0026  0.0009   217.40496   -972.48296  1:05
  70%  0.63 0.25 0.30 0.30 0.97 0.33 0.29 0.0038   10 111 P[5]=0.9893 0.0026  0.0009   216.82582   -972.50246  1:10
  75%  0.63 0.25 0.30 0.30 0.97 0.33 0.29 0.0037   10 111 P[5]=0.9896 0.0026  0.0009   204.99588   -972.56907  1:15
  80%  0.63 0.25 0.30 0.30 0.97 0.33 0.29 0.0036   10 111 P[5]=0.9897 0.0026  0.0009   217.51889   -972.54354  1:21
  85%  0.63 0.25 0.30 0.30 0.97 0.33 0.28 0.0037   10 111 P[5]=0.9893 0.0026  0.0009   212.80419   -972.51050  1:27
  90%  0.63 0.25 0.30 0.30 0.97 0.33 0.29 0.0037   10 111 P[5]=0.9896 0.0026  0.0009   223.34976   -972.47616  1:33
  95%  0.63 0.25 0.30 0.30 0.97 0.33 0.29 0.0036   10 111 P[5]=0.9893 0.0026  0.0009   215.63544   -972.48464  1:39
 100%  0.63 0.25 0.30 0.30 0.97 0.33 0.28 0.0037   10 111 P[5]=0.9895 0.0026  0.0009   201.02451   -972.47685  1:45

1:45 spent in MCMC

Summarizing the species-delimitation sample in file out.mcmc.txt

Number of species-delimitation models = 5

     model    prior    posterior
   1 000   0.200000   0.000000
   2 100   0.200000   0.000000
   3 101   0.200000   0.004630
   4 110   0.200000   0.005960
   5 111   0.200000   0.989410

Order of ancestral nodes:
  KCLH
  KC
  LH

Guide tree with posterior probability for presence of nodes:
((K, C)#0.995370, (L, H)#0.994040)#1.000000;;

The starting species delimitation model is generated by choosing at random one of the models defined by the guide tree or starting tree. After the chain has started, columns 2-6 give the acceptance proportions for the conventional MCMC moves discussed above while column 7 (rj) now shows the acceptance proportion for reversible jump proposals (collapsing or expanding species delimitations on the guide tree). In general the larger this proportion, the more efficient the rjMCMC algorithm is. However there is no optimal acceptance proportion for the rjMCMC move, and a value close to 0 may not necessarily mean a problem. If one model has posterior probability close to 1, the acceptance proportion should be near 0 as well. Thus both poor mixing of the rjMCMC algorithm and extreme posterior model probabilities can cause the acceptance proportion for the rjMCMC to be close to 0. It has been noted that if the rjMCMC algorithm is suffering from poor mixing, different starting species trees often lead to different results. Next there are three numbers related to the rjMCMC move. The rest of the line shows the posterior means for \theta and \tau_0 of the root ancestral population (which exist in all species-tree or species delimitation models), the current log MSC density and average log sequence likelihood. The three numbers in columns 8-10 that are related to the rjMCMC move, for example,

10 111 P[5]=0.9895

represent the number of parameters in the current model (np), in this case 10, the species delimitation, in this case 111, and the current posterior probability of the most probable delimitation P[5]=0.9895. This means that delimitation model 5 (111) is the most favoured model, with the posterior at 0.9895.

After the MCMC is finished, the program will summarize the sample. This output is:

Summarizing the species-delimitation sample in file out.mcmc.txt

Number of species-delimitation models = 5

     model    prior    posterior
   1 000   0.200000   0.000000
   2 100   0.200000   0.000000
   3 101   0.200000   0.004630
   4 110   0.200000   0.005960
   5 111   0.200000   0.989410

Order of ancestral nodes:
  KCLH
  KC
  LH

Guide tree with posterior probability for presence of nodes:
((K, C)#0.995370, (L, H)#0.994040)#1.000000;;

The five delimitation models are listed, together with their posterior and prior probabilities.

MCMC output file

The MCMC output was saved in the file out.mcmc.txt. As the number of parameters changes when the rjMCMC moves between models, the mcmc sample file may not be very useful, so you can often ignore it. Right now the header line is generated using the starting species tree and should be ignored. After the header line, each line of output has the following numbers, separated by TABs: iteration number, the number of parameters, the tree, the sampled parameter values, and lnL. Here are the first 6 lines of out.mcmc.txt:

Gen	np	tree	theta_1K	theta_2C	theta_5KCLH	theta_6KC	theta_7LH	tau_5KCLH	tau_6KC	lnL
2	10	111	0.001207	0.003438	0.003433	0.000722	0.004404	0.003324	0.000834	0.000736	0.000516	0.000528	-972.035
4	10	111	0.001207	0.003438	0.001733	0.000874	0.004570	0.003914	0.001036	0.000736	0.000596	0.000528	-971.105
6	10	111	0.001207	0.003438	0.003411	0.001107	0.003353	0.001307	0.001944	0.000736	0.000708	0.000386	-973.526
8	10	111	0.001698	0.004529	0.001902	0.000913	0.003032	0.000349	0.001474	0.000607	0.000584	0.000346	-972.899
10	10	111	0.001979	0.005280	0.002217	0.001065	0.004159	0.000407	0.001990	0.000707	0.000680	0.000348	-970.674

If you know the unix command grep, you can retrieve the lines for the same tree model to summarize the posterior for parameters in that model, for example,

    grep "3 111" out.mcmc.txt > result.Tree111.txt

In theory this should give you the same posterior as if you run analysis A00 with the species tree fixed at tree 111. In practice it is simpler to edit the Imap file and the control file to run analysis A00.

Running rjMCMC Algorithms.

  • The rjMCMC algorithms for species delimitation allow the chain to move from one model to another but can have mixing problems. Check that similar results are produced from multiple runs using Algorithm0 and Algorithm1 regardless of the starting species tree.

    The starting tree is chosen by the program at random and will vary among runs. Make sure that some of your runs are started with the one-species model, some from the fully resolved tree, and some from other trees in between. If you get consistent results among runs with different starting trees and using the two algorithms, you are unlikely to have a convergence or mixing problem.

    If you have a computer with multicore, you can run those different combinations or replicates in different folders at the same time.

  • In medium-sized or large datasets with multiple loci, we have come across cases where the chain is stuck at the one-species model, or have difficulty moving into the one-species model. The problem is less common when there are only 1 or 2 loci. If you have a similar problem, you may start the analysis with 1 locus, then 2 loci, etc. to observe how the results change (you can do this by changing nloci in the control file as there is no need to change the sequence file).

  • The program used the burnin to adjust the step lengths for the proposals in the MCMC algorithm. If the rjMCMC stays in species model 0, which does not have any \tau parameter, no information is collected during the burnin about the proposals to change \tau and the automatically adjusted step length for \tau can be very poor.

  • You probably need to evaluate the impact of the priors on $\theta$s and \tau. See the note about the gamma distribution later in this document.

A11: Joint Species Delimitation and Species Tree Estimation

Analysis A11 (speciedelimitation = 1, speciestree = 1) assumes that the species delimitation is unknown (e.g., population assignments as specified in the Imap file may not represent distinct species) and also that the species tree topology relating the species of any delimitation must be estimated (see Yang and Rannala 2014). The program calculates the joint posterior probabilities of different possible species delimitations and species tree topologies as well as of \theta$s and \tau$s.

Input A11

Our example uses the dataset of frog sequence data generated by Zhou et al 2012 that we considered previously. The contents of the control file A11.bpp.ctl are shown below:

	seed =  -1

	seqfile = frogs.txt
	Imapfile = frogs.Imap.txt
	jobname = out

	speciesdelimitation = 1 1 2 1  * species delimitation rjMCMC algorithm1 finetune (a m)
	speciestree = 1  0.4 0.2 0.1   * speciestree pSlider ExpandRatio ShrinkRatio
	speciesmodelprior = 1  * 0: uniform LH; 1:uniform rooted trees; 2: uniformSLH; 3: uniformSRooted

  species&tree = 4  K  C  L  H
                    9  7 14  2
                 (((K, C), L), H);
         phase =   1  1  1  1
                  
       usedata = 1  * 0: no data (prior); 1:seq like
         nloci = 5  * number of data sets in seqfile

     cleandata = 0    * remove sites with ambiguity data (1:yes, 0:no)?

   thetaprior = gamma 2 2000 # gamma(a, b) for theta (estimate theta)
     tauprior = gamma 2 1000 # gamma(a, b) for root tau & Dirichlet(a) for other tau's

*     heredity = 1 4 4
*    locusrate = 1 5

      finetune = 1  # finetune for GBtj, GBspr, theta, tau, 
mix, locusrate, seqerr

         print = 1 0 0 0   * MCMC samples, locusrate, heredityscalars, Genetrees
        burnin = 8000
      sampfreq = 2
       nsample = 100000

the lines:

	speciesdelimitation = 1 1 2 1 * species delimitation rjMCMC algorithm1 finetune (a m)
	speciestree = 1  0.4 0.2 0.1   * speciestree pSlider ExpandRatio ShrinkRatio

specify that the rjMCMC algorithm 1, with \alpha = 2 and m = 1 in equations 6 and 7 of Yang and Rannala 2010 is used for species delimitation and the species tree topology is being estimated speciestree = 1. As noted above, the 3 parameters following the speciestree variable specify the probability that the SNL move is used, rather than the subtree-pruning-regrafting (SPR) move to modify the species tree and the expand/shrink ratios for the SNL move; these proportions can be adjusted on the interval (0,1) and will affect mixing of the MCMC. The line:

	speciesmodelprior = 1  * 0: uniform LH; 1:uniform rooted trees; 2: uniformSLH; 3: uniformSRooted

specifies the prior distribution on delimitations and tree topologies. For analysis A11, speciesmodelprior can take the four values 0, 1, 2, 3, which mean Priors 0, 1, 2, 3, respectively. As mentioned above, Prior 1 (which is the default) assigns equal probabilities to the rooted species trees, while Prior 0 means equal probabilities for the labeled histories (rooted trees with the internal nodes ordered by age). Priors 2 and 3 assign equal probabilities for the numbers of species (1/s each for 1,2,\ldots,s species given s populations) and then divide up the probability for any specific number of species among the compatible models (of species delimitation and species phylogeny) either uniformly (Prior 3) or in proportion to the labeled histories (Prior 2). Priors 2 and 3 are discussed in Yang and Rannala 2014. Prior 3 may be suitable when there are many populations.

Output A11

When BPP is run using the above control file a summary of the progress of the MCMC is again printed to screen as follows:

     |               Acceptance proportions                |
Prgs | Gage Gspr  th1  th2  thg  tau  mix   Sspr   Ssnl  rj | sp np        mldp theta1    tau1       log-PG        log-L
------------------------------------------------------------------------------------------------------------------------
(some output omitted here)
   5%  0.65 0.26 0.30 0.30 0.85 0.28 0.30 0.0904 0.0000 0.0000    4 10 P[4]=1.0000 0.0041  0.0017   1239.61701  -4439.20352  0:59
  10%  0.65 0.26 0.30 0.30 0.86 0.27 0.30 0.0964 0.0000 0.0000    4 10 P[4]=1.0000 0.0042  0.0017   1221.22458  -4437.63784  1:35
  15%  0.65 0.26 0.30 0.30 0.87 0.26 0.30 0.0962 0.0000 0.0000    4 10 P[4]=1.0000 0.0042  0.0017   1238.23420  -4436.36392  2:13
  20%  0.65 0.26 0.30 0.30 0.88 0.26 0.30 0.0998 0.0000 0.0000    4 10 P[4]=1.0000 0.0042  0.0016   1207.06023  -4435.09525  2:54
  25%  0.65 0.26 0.30 0.30 0.89 0.26 0.30 0.1005 0.0000 0.0000    4 10 P[4]=1.0000 0.0043  0.0016   1211.57636  -4434.31571  3:37
  30%  0.65 0.26 0.30 0.30 0.90 0.26 0.30 0.1018 0.0000 0.0000    4 10 P[4]=1.0000 0.0043  0.0016   1199.97256  -4434.32883  4:19
  35%  0.65 0.26 0.30 0.30 0.91 0.26 0.30 0.1023 0.0000 0.0000    4 10 P[4]=1.0000 0.0043  0.0016   1200.88102  -4433.94315  4:57
  40%  0.65 0.26 0.30 0.30 0.92 0.26 0.30 0.1002 0.0000 0.0000    4 10 P[4]=1.0000 0.0044  0.0016   1191.04407  -4434.06936  5:38
  45%  0.65 0.26 0.30 0.30 0.93 0.26 0.30 0.1045 0.0000 0.0000    4 10 P[4]=1.0000 0.0043  0.0016   1193.71849  -4434.12002  6:21
  50%  0.65 0.26 0.30 0.30 0.94 0.26 0.30 0.1036 0.0000 0.0000    4 10 P[4]=1.0000 0.0043  0.0016   1247.11644  -4434.33624  7:05
  55%  0.65 0.26 0.30 0.30 0.95 0.26 0.30 0.1017 0.0000 0.0000    4 10 P[4]=1.0000 0.0043  0.0016   1218.84106  -4434.33556  7:43
  60%  0.65 0.26 0.30 0.30 0.96 0.26 0.30 0.0994 0.0000 0.0000    4 10 P[4]=1.0000 0.0043  0.0016   1233.73293  -4434.00290  8:22
  65%  0.65 0.26 0.30 0.30 0.96 0.26 0.30 0.1005 0.0000 0.0000    4 10 P[4]=1.0000 0.0043  0.0016   1235.85799  -4433.85179  9:06
  70%  0.65 0.26 0.30 0.30 0.97 0.26 0.30 0.0995 0.0000 0.0000    4 10 P[4]=1.0000 0.0043  0.0016   1218.90538  -4434.20067  9:50
  75%  0.65 0.26 0.30 0.30 0.97 0.26 0.30 0.1002 0.0000 0.0000    4 10 P[4]=1.0000 0.0043  0.0016   1214.40621  -4434.67870  10:32
  80%  0.65 0.26 0.30 0.30 0.97 0.26 0.30 0.0999 0.0000 0.0000    4 10 P[4]=1.0000 0.0043  0.0016   1215.56021  -4435.19959  11:13
  85%  0.65 0.26 0.30 0.30 0.97 0.26 0.30 0.0980 0.0000 0.0000    4 10 P[4]=1.0000 0.0043  0.0016   1227.95558  -4435.47778  11:52
  90%  0.65 0.26 0.30 0.30 0.97 0.26 0.30 0.0963 0.0000 0.0000    4 10 P[4]=1.0000 0.0042  0.0016   1225.62882  -4435.73626  12:35
  95%  0.65 0.26 0.30 0.30 0.97 0.27 0.30 0.0958 0.0000 0.0000    4 10 P[4]=1.0000 0.0042  0.0017   1244.11759  -4435.87327  13:19
 100%  0.65 0.26 0.30 0.30 0.97 0.26 0.30 0.0949 0.0000 0.0000    4 10 P[4]=1.0000 0.0042  0.0017   1214.44552  -4436.19194  14:03

14:03 spent in MCMC


(A) List of best models (count postP #species SpeciesTree)
24746 0.247460 0.247460 4  (C H K L)  ((C, (H, L)), K);
20105 0.201050 0.448510 4  (C H K L)  (C, ((H, L), K));
10918 0.109180 0.557690 4  (C H K L)  (C, ((H, K), L));
 9358 0.093580 0.651270 4  (C H K L)  ((C, K), (H, L));
 6874 0.068740 0.720010 4  (C H K L)  ((C, (H, K)), L);
 5122 0.051220 0.771230 4  (C H K L)  (((C, H), L), K);
 4616 0.046160 0.817390 4  (C H K L)  (C, (H, (K, L)));
 3746 0.037460 0.854850 4  (C H K L)  (((C, K), H), L);
 3681 0.036810 0.891660 4  (C H K L)  (((C, H), K), L);
 3080 0.030800 0.922460 4  (C H K L)  (((C, L), H), K);
 1741 0.017410 0.939870 4  (C H K L)  ((C, L), (H, K));
 1693 0.016930 0.956800 4  (C H K L)  (((C, K), L), H);
 1691 0.016910 0.973710 4  (C H K L)  ((C, H), (K, L));
 1474 0.014740 0.988450 4  (C H K L)  ((C, (K, L)), H);
 1155 0.011550 1.000000 4  (C H K L)  (((C, L), K), H);

(B) 1 species delimitations & their posterior probabilities
100000 1.000000   4 (C H K L)

(C) 4 delimited species & their posterior probabilities
100000 1.000000 H
100000 1.000000 C
100000 1.000000 L
100000 1.000000 K

(D) Posterior probability for # of species
P[1] = 0.000000  prior[1] = 0.238095
P[2] = 0.000000  prior[2] = 0.238095
P[3] = 0.000000  prior[3] = 0.285714
P[4] = 1.000000  prior[4] = 0.238095

The arrangement of acceptance proportions, running means etc, are very similar to those of analysis A10, except that there are two additional columns (with headers Sspr and Ssnl) that provide the acceptance proportions for the SPR and SNL moves proposing changes to the species tree topology. There are four sections of output that summarize the results. Section (A) lists the best models in the decreasing order of the posterior probabilities. Here a model is a full MSC model that species both the species delimitation and species phylogeny. From this section, one can easily construct the 95% or 99% credibility sets of models. This section is further summarized to produce sections B, C, and D. Section (B) gives the posterior probabilities for the top few delimitations. Section (C) lists the delimited species and their posterior probabilities, and section (D) lists the posterior probability for the number of species, together with the prior probabilities calculated by BPP.

MCMC output file

The sampled trees and delimitations from the MCMC are printed to the specified file out.mcmc.txt. An example of 5 lines from this file is:

(C #0.010039: 0.001675, ((L #0.006075: 0.001466, H #0.003617: 0.001466) #0.002155: 0.000205, K #0.003031: 0.001671) #0.000955: 0.000004) #0.004713; 4
(C #0.009000: 0.001462, ((L #0.006482: 0.001228, H #0.001665: 0.001228) #0.001957: 0.000230, K #0.002632: 0.001458) #0.000511: 0.000004) #0.003204; 4
((C #0.009488: 0.001537, K #0.002525: 0.001537) #0.001082: 0.000004, (L #0.006926: 0.001384, H #0.002947: 0.001384) #0.001931: 0.000157) #0.003378; 4
((C #0.010464: 0.001806, K #0.002966: 0.001806) #0.001272: 0.000004, (L #0.008138: 0.001487, H #0.002791: 0.001487) #0.002480: 0.000323) #0.004458; 4
((C #0.009022: 0.001765, K #0.002899: 0.001765) #0.001243: 0.000004, (L #0.007955: 0.001449, H #0.003637: 0.001449) #0.002001: 0.000321) #0.004358; 4

Because the number of species delimited and the tree topology are both potentially changing during the MCMC this file is usually not useful for summarizing the results unless a custom script filtering the MCMC samples is used. This file is used by the program to produce the summaries printed to screen at the end of the run.

Adjusting step lengths for MCMC moves (finetune)

The specified proposal step lengths are the initial values when automatic adjustment is used and are the fixed step lengths when manual specification of step lengths is used. The automatic adjustment of the finetune variable (MCMC step lengths) appears to be reliable and is recommended. However, be sure to check that the resulting acceptance proportions are neither too small nor too large. Here we provide some guidance for manual adjustments of the step lengths. A good strategy is to use automatic adjustments initially to generate good step lengths and then copy the step lengths into the control file, while continuing to use automatic adjustment; that way the next time the control file is run the automatic adjustment procedure will start with near-optimal step lengths and less optimization will therefore be required.

Adjusting the step lengths manually (finetune = 0)

First note the following line found in the control file yu2001.bpp.ctl. Here finetune = 1 means that MCMC step lengths will be adjusted automatically, and the specified values are used as initial values.

    finetune = 1

There are seven finetune steplengths here. They are in a fixed order and always read by the program even if the concerned proposal is not used. The first five of them are \epsilon_1, \epsilon_2, \epsilon_3, \epsilon_4, and \epsilon_5, described in (Rannala and Yang 2003). These are the step lengths used in the MCMC proposals that (1) change internal node ages in the gene tree, (2) prune and re-graft nodes in the gene tree (SPR), (3) update \theta, (4) update $\tau$s using the rubber-band algorithm, and (5) implements the mixing step. The 6th and 7th are for the proposals that change the locus rates or heredity multipliers and that change the sequencing errors, respectively. If the model assumes the same rate for all loci and does not use heredity multipliers, the 6th proposal step is not used. If the model assumes no sequencing errors, the 7th step is not used. The acceptance proportions for the first five proposals are always printed out on the screen, but those for the 6th and 7th are printed out only if the concerned proposal is used in the model. In the example above, only the first five proposals are used in the algorithm and we will manually change the step lengths so that the acceptance proportions become close to 30%. First, edit the line, changing it to:

    finetune = 0

The basic strategy for adjusting fine-tune parameters is if the acceptance proportion is too small (e.g., <0.10), decrease the corresponding finetune parameter. If the acceptance proportion is too large (e.g., >0.80), increase the finetune parameter. Run the program for a small number of iterations and look at the screen output to examine the acceptance proportions:

   0%  0.71 0.19 0.34 0.00 0.41   0.0004    463.81031  -12720.98567  0:04
   5%  0.72 0.19 0.32 0.00 0.41   0.0003    458.65988  -12720.53426  0:04
  10%  0.72 0.19 0.34 0.00 0.42   0.0004    454.99289  -12720.66361  0:05
  15%  0.72 0.19 0.34 0.00 0.41   0.0004    481.20520  -12720.78839  0:06

Here the first acceptance proportion, at 0.72, appears too large, which means that the corresponding finetune parameter (2 in the control file) is too small, similarly the second acceptance proportion, at 0.19, appears too small, which means that the corresponding finetune parameter is too large. Terminate the run (Ctrl-C) and edit the finetune values in the control file and then run the program again, checking the acceptance rates. Repeat this process a few times until every acceptance proportion is neither too small nor too large. In this example, changing the second finetune parameter (SPR) from 0.00001 to 0.000003 brings the acceptance proportion to about 0.30, namely:

  10%  0.71 0.31 0.34 0.00 0.30   0.0004    447.59035  -12721.04474  0:06
  15%  0.71 0.30 0.33 0.00 0.30   0.0004    487.91342  -12720.96697  0:07
  20%  0.71 0.30 0.32 0.00 0.30   0.0003    430.67545  -12720.83600  0:08

However, increasing the first finetune parameter (even by an order of magnitude to 20) has little effect. Sometimes it will not be possible to reduce the acceptance proportion for a parameter, as in this case (even using automatic adjustment produces an acceptance proportion of about 0.71 in this case).

The MCMC proposals discussed above are used in all four analyses (A00, A01, A10, A11), so that the description here applies to all of them. Note that the finetune parameters affect the efficiency of the MCMC or how fast one can obtain reliable results. In theory they do not change the results if runs using different finetune parameters (with potentially different acceptance proportions) are all run for long enough to generate reliable results.

Simulating Gene Trees and Alignments Using BPP

The --simulate option of BPP4 replaces the earlier MCCOAL program distributed with BPP versions 3.4 and earlier. This option can be used to simulate gene trees and sequence alignments at multiple loci under the MSC (Rannala and Yang 2003) and MSC-I (Flouri et al 2020) models. The simulation program allows a GTR+G DNA substitution model (and its special cases) and allows among-loci heterogeneity in the process of sequence evolution. The different loci can have different exchangeability parameters (a, b, c, d, e, f) and base compositions in the GTR model, different overall evolutionary rates, differing extents of among-site rate variation (reflected in the alpha parameter for the gamma model), and different among-species rate drift processes (violations of the clock). See @Shi2018 for examples of such simulations. The simulation option also includes a MSC-M continuous migration model, with a user-specified migration rate matrix between species/populations.

Running the simulation program

To run BPP using the simulation option, create a suitable control file (for example, named MCcoal.ctl) and type the following:

bpp --simulate MCcoal.ctl

Always examine the screen output carefully to confirm that the program has read and executed the control file correctly.

Simulation under the MSC model

The control file

Here we consider a simple example of a simulation under the MSC model with no migration or introgression. The example control file for simulating sequence alignments and gene trees has the following content:

    seed = 12345
    seqfile = MySeq.txt  * comment out this line if you don't want seqs
    treefile = MyTree.tre  * comment out this line if you don't want trees
    Imapfile = MyImap.txt
    *   concatfile = concatenatedfile.txt  * concatenated alignment
    modelparafile = modelparas.txt   * comment out this line if you don't want seqs

    species&tree = 4  A  B  C  D
    3  2  1  1
    ((A #0.01, B #0.01) :0.01 #.01, (C, D) :0.011 #0.01) : 0.012 #0.01;
    phase =    1  1  0  0   * 0: do not phase (fully phased seqs), 1: diploid unphased seqs

    loci&length = 100 1000 * number of loci & number of sites at each locus
    *    locusrate = 0 (default: same rate for all loci)
    *    locusrate = mu_bar a_mui prior
    *    clock = 1 (default: strict clock)
    *    clock = 2 v_bar a_vi prior dist  (independent-rates)
    *    clock = 3 v_bar a_vi prior dist  (correlated-rates)

    model = 7       * model: 0:JC69, 7:REV (GTR)
    Qrates = 0  10 5 5 5 5 10     * 1: fixed; 0: dirichlet, for TC TA TG CA CG AG
    basefreqs = 0  10  10  10  10   * 0: random, Dirichlet(aT,aC,aA,aG), for base frequencies
    alpha_siterate = 0  100  20  5  * G(a, b) for alpha for sites & K for discrete gamma

We now go through each control file variable and explain its purpose.

seed
Use seed = -1 to simulate different datasets each time the program is run (obtaining a random number seed from the computer clock). If you use a positive integer as a seed the data will be exactly the same each time the program is run with that control file; this is usually not what you want to do.

seqfile, treefile, Imapfile, concatfile, modelparafile
These variables specify the names of files to be generated. If you want to simulate gene trees and not sequence files, you can comment out the line for the seqfile. The file specified by concatfile will contain the sequence alignment concatenated across loci. The sequence files can become very large. The file specified by modelparafile contains the parameter values for the GTR model, as well as the locus rate and the rates for nodes on the species tree. There is one line of output per locus.

phase
This variable is used in the same way as in the BPP inference (data analysis) mode. Each species is assigned a switch/flag, with 0 meaning fully phased (haplotype) sequences and 1 for unphased diploid sequences. With the specifications in the example (sampling configuration 3 2 1 1 and phase = 1 1 0 0), the program will simulate 6, 4, 1, 1 sequences for A, B, C, D, respectively, and then combine every two sequences from A, B, C into one single diploid sequence with heterozygote sites represented using ambiguity characters (YRMKSW). If you use the same random number seed, the diploid data generated using the sampling configuration (3 2 1 1) with phase = 1 1 0 0 should match the fully resolved sequences generated using the sampling configuration (6 4 1 1) with phase = 0 0 0 0. The program also prints out the fully resolved sequences in a file with the suffix _full (or MySeq_full.txt in the example).

loci&length
This variable specifies the number of loci to be simulated and the length (number of sites) for each loci. In this example, 100 loci, each of 1000 sites, will be simulated.

species&tree
This block specifies the number and names of species, the species tree, and the parameters under the multispecies coalescent model, including the species divergence times ($\tau$s) and population size parameters (\theta = 4N\mu). For the example above, 100 loci, each of 1000 sites, will be simulated, on the species tree ((A, B), (C, D)), with 3, 2, 1, 1 sequences for A, B, C, D, so that there are 7 sequences at each locus. The divergence time parameters ($\tau$s) are after : in the tree, while the population size parameters ($\theta$s) are after #. Thus we have 0.01 for all $\theta$s, and \tau_{ABCD} = 0.012, \tau_{AB} = 0.01, and \tau_{CD} = 0.011. We need \theta_A and \theta_B because 2 or more sequences are sampled from species A and B. Parameters \theta_C and \theta_D are unnecessary in this case as only one sequence is sampled from C and D: if you specify them, they will be ignored by the program. Note that both \theta$s and \tau$s are measured by the expected number of mutations per site, so that \theta = 0.01 means that two sequences sampled from the population are 1% different. For reference, the estimate for the human species is \theta_H = 0.0006.

model
This variable can take two possible values: 0 for JC69 and 7 for GTR. The next few lines are relevant for the GTR model.

Qrates
This variable specifies the exchangeability parameters in the GTR model (a, b, c, d, e, f for TC, TA, TG, CA, CG, and AG, in Yang 1994). There are two options, either to have those rates fixed for all loci or to have them sampled at random. The first has the following format (note that the first 0-1 number is a switch):

Qrates = 1  2 1 1 1 1 2   *  1: fixed; for TC TA TG CA CG AG

The input is one integer value (0 or 1) which acts as a switch followed by six real numbers. The line above fixes the rates at a = 2, b = c = d = e = 1 and f = 2, so that the transition rate is twice as high as the transversion rate, and the model corresponds to K80 or HKY. Note that only the relative rates matter, because the rate matrix (Q) is scaled so that the average rate (over the base frequencies) is 1 and branch lengths are measured in the expected number of mutations/substitutions per site. Nevertheless the program expects six rate parameters in the input here:

Qrates = 0  10 5 5 5 5 10   *  0: dirichlet, for TC TA TG CA CG AG

The second option, above, is to sample a, b, c, d, e from the Dirichlet distribution for every locus. The above specifies Dir(10, 5, 5, 5, 5, 10), with parameters \alpha_a = 10, \alpha_b = \alpha_c = \alpha_d = \alpha_e = 10, and \alpha_f = 10. The rates generated from the Dirichlet sum to 1, and they are rescaled. Note that larger values for those parameters mean less variance, while the mean for a, say, is given by \alpha_a/\alpha with $\alpha = \alpha_a + \alpha_b + \alpha_c + \alpha_d + \alpha_e + \alpha_f$. The specification here gives on average a transition/transversion rate ratio of 2 (if the base frequencies are fixed at \frac{1}{4} each), but it varies among loci.

basefreqs
The base frequency parameters (\pi_T, \pi_C, \pi_A, \pi_G) can also be fixed or sampled from the Dirichlet distribution, like the Qrates. The two options are as follows:

    basefreqs = 1 0.15 0.35 0.15 0.35  * 1: fixed; Base frequencies are for TCAG.
    basefreqs = 0  10  10 10  10       * 0: random, Dirichlet(aT, aC, aA, aG), for base frequencies

alpha_siterate
The gamma shape parameter (\alpha) for rate variation among sites of the same locus can be fixed or sampled from a gamma distribution. The possible options are as follows. When alpha is fixed, the same value is used for all loci. Otherwise different $\alpha$s are used for different loci. Note that given alpha, the rates for sites at the same locus have a G((\alpha, \alpha) distribution with mean 1 [@Yang1993; @Yang1994]. The fourth option below will allow the program to sample \alpha from G(100, 20), with mean 5, for each locus and then use G(\alpha, \alpha) to describe the among-site rate variation for the locus:

    alpha_siterate = 1 0            * 1: alpha fixed at 0(inf), one rate for all sites at the locus
    alpha_siterate = 1  5.6 0       * 1: alpha fixed at 5.6, K = 0(inf) for continuous gamma
    alpha_siterate = 1  5.6 5       * 1: alpha fixed at 5.6, K = 5 categories for discrete gamma
    alpha_siterate = 0  100  20  5  * 0: alpha sampled from G(100, 20), with mean 5, K = 5 for discrete gamma

The variables locusrate and clock are used to specify relaxed-clock models, with rate variation among branches and among loci. These are the same models as implemented in the inference program. Please see Models of Substitution Rate Variation for details.

locusrate
This specifies variable rates for different loci. The default is 0, meaning that all loci have the same rate. To specify variable rates for loci, use the following format:

    locusrate = 0 (default)
    locusrate = mu_bar a_mui prior
    locusrate = mu_bar a_mui
    locusrate = 1.0 5.0 dir

Here mu_bar is the mean rate across loci. If prior = dir (gamma-Dirichlet), the total rate (L\bar\mu) is partitioned to generate the locus-rates (\mu_i) according to the Dirichlet distribution with concentration parameter \alpha (a_mui). Large \alpha (10 or 100, say) means that the rates are similar among loci, while small values (1 or 0.5, say) mean that rates are highly variable among loci. If prior = iid (conditional i.i.d.), the locus rates (\mu_i) are i.i.d. given the mean rate (\bar\mu):

    mu_i ~ Gamma(a_mui, a_mui/mubar)

clock
This variable is used to specify strict-clock or relaxed-clock models. The default is clock = 1 for strict clock, while clock = 2 is the independents-rates model, and clock = 3 is the correlated-rates model (which is implemented for the MSC model with no introgression and is unavailable for the MSC-I model).

    clock = 1 (default: strict clock)
    clock = 2 v_bar a_vi prior dist  * independent-rates model
    clock = 2 0.1 10 dir G    * gamma-dirichlet for loci & gamma for branches
    clock = 2 0.1 10 iid LN   * iid for loci & log-normal for branches
    clock = 3 v_bar a_vi prior dist  * correlated-rates model
    clock = 3 0.1 10 iid G    * iid for loci & gamma for branches
    clock = 3 0.1 10 iid LN   * iid for loci & log-normal for branches

The specification (clock = 2 0.1 10 dir G) means the following. First the average variance parameter is = 0.1. Then the total L\bar\mu is partitioned into \mu_i (for i = 1, 2, \cdots, L) according to the Dirichlet distribution with concentration parameter \alpha = 10 (a_vi). In contrast, the specification (clock = 2 0.1 10 iid LN) means that the variance parameter for locus \nu_i is generated as \nu_i|\bar\nu \sim G(\alpha, \alpha/\bar\nu) with shape parameter \alpha = 10 (a_vi) and mean \bar\nu = 0.1. In both prior models (prior=dir and iid), \alpha (a_vi) is inversely related to the variance in \mu_i among loci: use small values of \alpha (2, 1, or 0.5) if the clock nearly holds at some loci but is seriously violated at others, and large values (such as 10 or 100) if the clock is violated in the same extent at different loci.

clock = 2
Given the locus rate \mu_i (specified using the locusrate variable) and the variance parameter \nu_i (specified using the clock variable) for locus i, the rates for species-tree branches are specified as follows. If dist = G (for gamma), the rate for branch j at locus i has the following gamma distribution with mean \mu_i and variance \nu_i

r_{ij} | \mu_i, \nu_i \sim G(\mu_i^2/\nu_i, \mu_i/\nu_i).

If dist = LN (for log-normal), the rate has the log-normal distribution

r_{ij} | \mu_i, \nu_i \sim LN(\mu_i, \nu_i).

clock = 3
The correlated-rates model is specified similarly, and for the MSC model only. Given the locus rate \mu_i (specified using the locusrate variable) and the variance parameter \nu_i (specified using the clock variable) for locus i, the rates for species-tree branches are specified recursively, starting from the root towards the tips. If dist = G (for gamma), the rate for branch j at locus i has the following gamma distribution with shape parameter \alpha = \mu_i^2/\nu_i and with the mean to be the rate for the parental branch of j or r_{i,p(j)}:

r_{ij} | \mu_i, \nu_i, r_{i,p(j)} \sim G(\frac{\mu_i^2}{\nu_i}, \frac{\mu_i^2}{\nu_i r_{i,p(j)}}).

If dist = LN (for log-normal), the rate for branch j at locus i has the log-normal distribution with the mean to be the parental rate and variance parameter \nu_i:

r_{ij} | \nu_i, r_{i,p(j)} \sim LN(r_{i,p(j)}, \nu_i).

After the rates for branches (populations) on the species tree are generated for the locus, they are used to calculate the gene-tree branch lengths. Gene-tree branches residing in the same species/populations have the same rate (the rate of that species at the locus), while those residing in different species may have different rates. A branch on a gene tree may have segments residing in different species/populations, and the length of the branch (measured by the expected number of mutations/substitutions per site) is calculated by adding up those segments.

Program output

Running the program on the above control file produces the following screen output, indicating that the simulation has been successful:

bpp --simulate MCcoal.ctl 
Site rates: alpha sampled from Gamma(100.000000,20.000000), K = 5
bpp v4.7.0_linux_x86_64, 15GB RAM, 8 cores
https://github.com/bpp/bpp

Detected CPU features: mmx sse sse2 sse3 ssse3 sse4.1 sse4.2 popcnt avx avx2
Auto-selected SIMD ISA: AVX2

Substitution model: GTR with generated rates from Dirichlet
                    10.000000 5.000000 5.000000 5.000000 5.000000 10.000000
Base frequencies: generated from Dirichlet
                  a_T=10.000000 a_C=10.000000 a_A=10.000000 a_G=10.000000
4 species: A (3) B (2) C (1) D (1)
  ((A #0.010000: 0.010000, B #0.010000: 0.010000) #0.010000: 0.002000, (C: 0.011000, D: 0.011000) #0.010000: 0.001000) #0.010000;

Map of populations and ancestors (1 in map indicates ancestor):
  Species   1  2  3  4  5  6  7
1 A         1  0  0  0  1  1  0  tau = 0.000000  theta = 0.010000
2 B         0  1  0  0  1  1  0  tau = 0.000000  theta = 0.010000
3 C         0  0  1  0  1  0  1  tau = 0.000000  theta = 0.000000
4 D         0  0  0  1  1  0  1  tau = 0.000000  theta = 0.000000
5 ABCD      0  0  0  0  1  0  0  tau = 0.012000  theta = 0.010000
6 AB        0  0  0  0  1  1  0  tau = 0.010000  theta = 0.010000
7 CD        0  0  0  0  1  0  1  tau = 0.011000  theta = 0.010000

Sequence data file -> MySeq.txt
Trees -> MyTree.tre
Model parameters for loci -> modelparas.txt
Tags to species mapping (Imap) -> MyImap.txt

Several output files are produced. The file MySeq.txt contains the simulated sequence alignments in Phylip/BPP format:

7 1000 

a1^A        ACATGCCACT ACACCGGACA TTAGAGCTAC GCGAGCTCTT TGWACTCGTT ACAACCTCAC AATGTAATAG TGTAATTACT TAGCTTAAGT AMT
CTTGATC TTTTCTATAR TTACATCGAA CGAATATCTG TACCTGAGCT TTTCACGATC CCTYCCTTCA TCTAGCAATC GTAAACTWTG TAAATTTCCT ACAGTCA
TAY TRATAACCCA TATCATGTAA CCAGACCCCC CTWAATTTMT CGAGAATGCC CMTCTTCATT CAATCCCAAA CAGTCAAAGC GTCCACAAAT TAATTGCACA 
TAACCATCGT AATTGGAGAA ATTCCACCAT TCAATAGTTT ACTTGATTMA AACTAGTGGA TCCCATGTAA GCATAATCCC CCTACYCCAT ATGTATCTTA GAGT
MTCGTT TGRGACTTTM CATGCCCCAG CTGTTTTTAA ATGCCAGTAA ACARCGGCGA CTACTATGTC TTACGACAGA ACGAGGTTTC CACTGAGAGT RCAAAGGA
TC ACTCGTCTAT AGTTCAAAAW TCATTGCACG ATGTTCTCGA TCTACCTAAA TCTTGCCTGC TTTTTCMCCA TGCAATACAA CACCGTTAAA CAATATCTTA A
TATCAATCG TACAGTCGAT GCAGTATAGC CGATACTCCT TAACCTAACT YTTCAATATG ACMTAATACT CAACTGTTGC GRTACCAATT ATCCMTGCTG TACTG
ATAAC TTTATTGAAT GCCAATMCTA TWATGATCTA TTTCAGAYTT AATTCACAAT GAATTCAATA CGAATTTTCC TATCGTCAGS ACATCAATTA GATTCACAT
G TKGRAAGATC TATTTTGCAT CGACAAATGC ACCACCGCTC CCTCGCCTCT AAATCGCTCA CAATCGAATT AGAAAATATA ACACWTCCAT TGATCAASCT AA
AAGCGCAC AGGGAGCGAT TGGTTCGAAA ATGAGTTACA ACGTAAAGTT CTCAGCATAA TGGRGGCTAT ACACCCAAAA
a2^A        ACATGCCACT ACACCGGACA TTAGAGCTAC GCGAGCTCTT TGTACTCGTT ACAACCTCAC AATGTAATAG TGTAATTACT TAGCTTAAGT AAT
CTTGATC TTTTCTATAA TTACATCGAA CGAATATCTG TACCTGAGCT TTTCACGATC CCTCCCTTCA TCTAGCAATC GTAAACTTTG TAAATTTCCT ACAGTCA
TAT TAATAACCCA TATCATGTAA CCAGACCCCC CTTAATTTCT CGAGAATGCC CATCTTCATT CAATCCCAAA CAGTCAAAGC GTCCACAAAT TAATTGCACA 
TAACCATCGT AATTGGAGAA ATTCCACCAT TCAATAGTTT ACTTGATTCA AACTAGTGGA TCCCATGTAA GCATAATCCC CCTACCCCAT ATGTATCTTA GAGT
CTCGTT TGGGACTTTC CATGCCCCAG CTGTTTTTAA ATGCCAGTAA ACAGCGGCGA CTACTATGTC TTACGACAGA ACGAGGTTTC CACTGAGAGT GCAAAGGA
TC ACTCGTCTAT AGTTCAAAAT TCATTGCACG ATGTTCTCGA TCTACCTAAA TCTTGCCTGC TTTTTCCCCA TGCAATACAA CACCGTTAAA CAATATCTTA A
TATCAATCG TACAGTCGAT GCAGTATAGC CGATACTCCT TAACCTAACT CTTCAATATG ACATAATACT CAACTGTTGC GATACCAATT ATCCATGCTG TACTG
ATAAC TTTATTGAAT GCCAATCCTA TTATGATCTA TTTCAGATYT AATTCACAAT GAATTCAATA CGAATTTTCC TATCGTCAGC ACATCAATTA GATTCACAT
G TGGGAAGATC TATTTTGCAT CGACAAATGC ACCACCGCTC CCTCGCCTCT AAATCGCTCA CAATCGAATT AGAAAATATA ACACTTCCAY TGATCAAGCT AA
AAGCGCAC AGGGAGCGAT TGGTTCGAAA ATGAGTTACA ACGTAAAGTT CTCAGCATAA TGGGGGCTAT ACACCCAAAA
...

The file MyTree.tre contains the simulated gene tree for each locus in Newick format:

((((((a1a^A:0.000217,(a2b^A:0.000182,a3a^A:0.000182):0.000035):0.000362,a2a^A:0.000579):0.000065,a3b^A:0.000644):0
.011379,c1^C:0.012023):0.001408,(a1b^A:0.010443,(((b1a^B:0.001294,b2b^B:0.001294):0.000858,b1b^B:0.002152):0.00144
4,b2a^B:0.003596):0.006847):0.002989):0.010039,d1^D:0.023471):0.000000; [TH=0.023471, TL=0.091502]
(((((a1a^A:0.000584,((a2b^A:0.000357,a3b^A:0.000357):0.000057,a3a^A:0.000414):0.000170):0.001213,a1b^A:0.001797):0
.000482,a2a^A:0.002279):0.008361,(b1a^B:0.001291,(b1b^B:0.000558,(b2a^B:0.000345,b2b^B:0.000345):0.000213):0.00073
2):0.009350):0.010901,(d1^D:0.014926,c1^C:0.014926):0.006615):0.000000; [TH=0.021541, TL=0.076273]
((((a1a^A:0.001025,((a1b^A:0.000262,a2a^A:0.000262):0.000003,a2b^A:0.000265):0.000760):0.003850,(a3a^A:0.003915,a3
b^A:0.003915):0.000961):0.005929,((b1a^B:0.000958,(b2a^B:0.000139,b2b^B:0.000139):0.000819):0.000315,b1b^B:0.00127
3):0.009531):0.005512,(d1^D:0.015947,c1^C:0.015947):0.000369):0.000000; [TH=0.016316, TL=0.072093]
...

The file MyImap.txt contains the Imap data. These files can be used as input to inference programs such as BPP along with a suitable control file that matches the simulated data .

Simulation with migration under the MSC-M model

Here we consider a simple example of a simulation under the MSC-M model with continuous migration.

The control file

The example control file for simulating sequence alignments and gene trees has the following content:

seed = -1
treefile = mytree.tre
Imapfile = myimap.txt
seqfile = mydata.txt
*concatfile = concat.txt
modelparafile = modelparas.txt
#phase = 0 0 0
species&tree = 3
A B C
4 4 4
((A #0.015, B #0.025) S #0.015 :0.01, C #0.025) :0.02 #0.025;
loci&length = 2000 500
model = 0
* JC
migration = 2
S C 0.1
A C 0.2 5

There are two major differences from the previous (MSC) example. First, in the species tree the ancestral population to clade (A, B) is given a label S:

species&tree = 3
A B C
4 4 4
((A #0.015, B #0.025) S #0.015 :0.01, C #0.025) :0.02 #0.025;

A label is needed if migration is going to be specified for the ancestral population. Second, there is a new migration block:

migration = 2
S C 0.1
A C 0.2 5

Here, two migration connections are specified with migration = 2. The first migration connection is from source population S (ancestor of AB) to target population C and migration occurs at the rate M_{SC} = 0.1 migrants per generation. The second migration connection is from source population A to target population C. In this case, the migration rate M_{AC} varies among loci with the mean to be 0.2 and the shape parameter to be 5. The migration rate from populations i to j is defined as M_{ij} = N_j m_{ij} , where m_{ij} is the proportion of individuals in population j that are migrants from population i in each generation. In the example above, M_{SC} = 0.1, which means that on average 0.1 individuals are immigrants from population S to population C. We use forward-time for our definition of rates as the rates are then more biologically meaningful. This control file format is used in BPP version 4.4 onward, and is different from the old MCcoal format, in which the labels and order for populations are fixed by the program. The control file included in the release ( MCcoal.im-3s-saturated.ctl ) simulates data on a species tree for three species, with eight migration rates.

Simulation with tip-dating under the MSC

Here we consider a simple example of a simulation under the MSC with tip-dating.

The control file

The example control file for simulating sequence alignments and gene trees has the following content:

seed =  1

seqfile = simulate.txt
treefile=simulate_trees.txt
Imapfile = simple.Imap.txt
datefile = dates.txt
seqDates = seqDates.txt

# fixed number of species/populations 
*speciesdelimitation = 0

# fixed species tree

species&tree = 3  A B C 
                  4 4 2
		  (A #0.001, B #0.001):.007 #0.001, (C #0.001, D #0.001):.004 #.001);

phase =   0 0 0 


loci&length = 100 1000
clock = 1
locusrate =0
model = 0

The only difference in the control file when using tip-dating is the inclusion of the datefile and seqDates options. datefile specifies the name/path to the file containing the sequence ages The ages are in units of expected number of substitutions, which is not the same as the inference program. The dates are assigned to populations. The number of sample dates must match the number of samples from each population. For example, in the below date file, there are 4 samples from population A with sample ages 0.00005 and 0.00006 substitutions per site.

A 0.00006
A 0.00005
A 0.00005
A 0.00006
B 0.00007
B 0
B 0
B 0
C 0
C 0

The seqDates option specifies the name/path of the output file for the date file with individual names with sample dates. The bpp simulator automatically names the sequences based on the population names. Since the sequences are not named in the input files for the simulator, the simulator must generate a file to match the dates to the sequences. Below is the seqDates file that corresponds to the datefile shown above.

A^a1 0.000050
A^a2 0.000050
A^a3 0.000060
A^a4 0.000060
B^b1 0.000000
B^b2 0.000000
B^b3 0.000000
B^b4 0.000070
C^c1 0.000000
C^c2 0.000000

The seqDates and datefile options must be used together in the simulator. A strict clock model (the default, which is equivalent to clock = 1) is required for simulating with tip dates. The simulator uses dates in units of expected substitutions, but the inference program uses dates in calendar time such as years or thousand years. The dates in the seqDates file can be converted to a unit of years by dividing by the per year substition rate. This is required to use the simulator to generate data to use in the inference program. For example, if we assume a substitution rate of 10^{8} per year and use the same example as above, the datefile to use for inference would be

A^a1 5000
A^a2 5000
A^a3 6000
A^a4 6000
B^b1 0
B^b2 0
B^b3 0 
B^b4 7000
C^c1 0 
C^c2 0 

BPP does not generate a file with the dates in years or similar units. The user must prepare this file after running the simulator.

Advanced Features of BPP

Threading and Checkpointing

Threads

BPP4 can use Single-Instruction-Multiple-Data (SIMD) instruction sets (also called vector instructions) available on modern processors. It automatically detects and uses the best instruction set available so you don't have to do anything about this. However, you can manually specify and force an instruction set in the control file using the arch tag. For instance, arch=SSE forces BPP to use the SSE instruction set even if AVX (which has twice the register size of SSE and thus in theory yields twice the speedup) is present on the system. To completely disable vector instruction, one can use the arch=CPU option. The available values for the arch tag are 'CPU', 'SSE', 'AVX', 'AVX2' and 'NEON'.

Fig-Numa

Modern computer architecture using Non-Uniform momery access (NUMA).

BPP4 can use multiple cores/threads. The control variable threads has the following syntax.

    Threads = 8 19 1

This means BPP will use 8 threads, starting from core/thread 19, with increment 1; in other words hardware threads 19-36 will be used. The software threads are pinned onto the hardware threads and they not allowed to migrate. We found that this helps with performance.

Modern clusters based on microprocessors use a common shared-memory configuration called NUMA (for non-uniform memory access). The cluster typically consists of two or four microprocessors interconnected on a local bus to a shared memory on a single motherboard.

You can use commands like lscpu to see the machine architecture. For example, on our server lscpu gives the following output:

    Architecture:          x86_64
    CPU op-mode(s):        32-bit, 64-bit
    Byte Order:            Little Endian
    CPU(s):                144
    On-line CPU(s) list:   0-143
    Thread(s) per core:    2
    Core(s) per socket:    18
    Socket(s):             4
    NUMA node(s):          4
    ...
    NUMA node0 CPU(s):     0-17,72-89
    NUMA node1 CPU(s):     18-35,90-107
    NUMA node2 CPU(s):     36-53,108-125
    NUMA node3 CPU(s):     54-71,126-143

This means that hardware threads 1-18 are on CPU0, while threads 73-90 are the hyperthreads on CPU0. The specification Threads = 8 19 1 thus uses 8 threads on CPU1. Our recommendation is that you do some tests yourself using threads = 2 or 4 or 8, and use options that work well for your servers. Adjust the step lengths first. Then use burnin=0 and a small nsample so that the running time is about 1-2 minutes. Change threads and record running time.

Make sure all threads for the same BPP job are on the same CPU. Use lscpu to see the machine configuration and htop to examine the load on the hardware threads.

Checkpointing

This option instructs BPP to create a checkpoint file (save the progress) after a specified number of MCMC iterations. The MCMC loop in BPP consists of N = burnin + sampfreq*nsample iterations, numbered as 1,2,\cdots,N. There are two formats, where X, Y are whole numbers:

    checkpoint = X
    checkpoint = X Y

In the first format, a single checkpoint is created after X MCMC iterations (including burnin).

In the second format, a checkpoint is created after X steps, and then additional checkpoints are created every Y steps. For example, if X = 10000 and Y = 10000, the first checkpoint is created at MCMC iteration 10000, and further checkpoints at iterations 20000, 30000, etc.

The checkpoint files are named JOBNAME.Z.chk, where JOBNAME is the label specified for the jobname option, and Z is the number of the checkpoint file, starting from 1 and incrementing with every new checkpoint file.

To resume from a checkpoint file, use the resume switch, i.e.

    bpp --resume checkpoint-file.chk

Marginal Likelihood Calculations

The C program BFdriver generates control files and job subscription scripts for running MCMC (using BPP or MCMCtree) to calculate the marginal likelihood (or the Bayes factor), as described in Rannala and Yang 2017.

The program takes a control file you provide (such as bpp.ctl) and generates K = 16 control files with different beta values, which are used to run bpp to sample from the different power posterior distributions. The program also generates job submission scripts and submit the jobs using qsub. All generated control files and output files are in the same current directory. The frogs dataset in the bpp release ((Yang 2015) is used as the example.

You need the following: a linux system with SUN grid engine managing job submission (including commonds such as qsub, qstat, qdel, etc.), and a C compiler. If you don't have this job submission system, you can use BFdriver to generate the control files and run the MCMC jobs from the command line.

Compiling and running BFdriver

    cc -o BFdriver -O3 BFdriver.c tools.c -lm
    BFdriver <controlfilename> <npoints> <scriptname.sh>
    BFdriver A00.ctl 16 tmp.sh

You may need to edit the following two lines inside BFdriver.c, and if you do, remember to compile the program after editing. Here bpp is assumed to be on your search path. You can use a full path for the executable prorgam, such as /home/gooduser/bin/bpp3.3. Also the second line is for submitting the jobs using qsub. Here the limits are set to 4G of RAM and 360 hours of running time. Check those values if necessary (and recompile).

    fprintf(fcommand, "     echo \"bpp %s.b$I.ctl > log.b$I.txt\" > %s\n", ctlf, scriptf);
    fprintf(fcommand, "     qsub -S /bin/bash -l h_vmem=4G -l tmem=4G -l h_rt=360:0:0 -cwd %s\n", scriptf);

Running the program

Create a folder inside frogs/, say bf1:

    mkdir frogs/bf1
    cd frogs/bf1

Prepare a control file (A00.ctl, say) for the A00 analysis in the folder. Check that it works. This should have a fixed species tree, which is ((K, C), (L, H)). Species delimitation and species tree estimation should be turned off. The control file specifies the priors for theta, tau, and also specifies burnin, nsample, sampfreq etc. Run bpp to confirm that the control file works. Then run BDdriver as follows:

    BFdriver A00.ctl 16 tree1.sh

Here A00.ctl is the control file we have prepared. K = 16 is the number of points in the Gauss-Legendre qradrature algorithm for numerical integration. You can use 8 for testing, and 16 or 32 for real calculation. tree1.sh is the temporary script file for job submission using qsub. The BFdriver command does a few things. First it reads the control file specified (A00.ctl) and creates 16 control files with names like A00.b01.ctl, ..., A00.b16.ctl. Each of those control files has the same content as A00.ctl except that one extra line is inserted at the beginning, like the following

    BayesFactorBeta = 0.122298 *  w=0.124629.ctl

This specifies the beta value when the control file is used to run BPP.

Second BFdriver creates a file named betaweights.txt, which lists the beta values and Gauss-Legendre weights. I have copied those values into an excel file in frogs/BFdriver.frogs.xls.

Third BFdriver creates a file named commands, which has the bash shell scripts for submitting the 16 jobs using qsub. You use the following to submit the jobs.

    source commands

You can look at the content of tree1.sh to see the script for the last job:

    more tree1.sh

which should have the content like the following:

    bpp --cfile bpp.b16.ctl > log.b16.txt

You can use qstat to check the status of the 16 jobs you have submitted. When the jobs are running, they generate output files in the current folder, such as mcmc.b01.txt, out.b01.txt, and log.b01.txt (which logs the screen output). After all jobs are finished, you can use grep to extract the line with BFbeta from screen log (this command is at the bottom of the file commands).

    grep BFbeta log.b*.txt

Then copy the ElnfX values into the excel file, and estimate the logarithm of the marginal likelihood by summing (weights * ElnfX / 2) over the 16 points. This gives the log marginal likelihood to be -3185.93.

Exercise and results

Duplicate the calculation for the alternative species tree (tree2) in the folder /bf2. Change the species tree topology to (((L, H), C), K), and use tree2.sh as the temporary job script file. Everything else should be the same as described above.

My runs gave the log marginal likelihood for tree 2 to be -3186.14. The ratio of the posterior probabilities for the two trees is then estimated to be

\frac{P_1}{P_2} = \mathrm{e}^{-3185.93 - (-3186.14)} = \mathrm{e}^{0.21} = 1.24.

With BPP4.0 and the inverse-gamma priors on \theta and $\tau$s, the MCMC runs (A01) gave the posterior probabilities for trees 1 and 2 as 0.167 and 0.137, with the ratio 1.22. The MCMC runs and the marginal likelihood calculations seem to agree with each other. (Note that with BPP3 and the gamma priors on \theta and $\tau$s, the posteriors are 0.16 and 0.13 with the ratio 1.2 (Yang 2015, fig.4).

Common errors and problems

Check the bpp control file by running bpp at the command line before submitting the jobs. Make sure that the bpp program is on your path or use a full path. You may have to edit the source file BFdriver.c and recompile.

Experimental Features (Use at Your Own Risk!)

This section is reserved for experimental features that are under development.


Troubleshooting

This section covers common errors, problems, and their solutions.

Installation Issues

"Command not found: bpp"

Problem: The shell cannot find the BPP executable.

Solutions:

  • Ensure BPP is compiled: run make in the src/ directory
  • Add BPP to your PATH: export PATH=$PATH:/path/to/bpp/src
  • Use the full path: /path/to/bpp/src/bpp --cfile control.ctl

Compilation errors on Mac

Problem: Compilation fails with errors about missing headers or incompatible flags.

Solutions:

  • Ensure Xcode command line tools are installed: xcode-select --install
  • For ARM Macs (M1/M2/M3), use the appropriate Makefile: make -f Makefile.ARM64

Control File Errors

"Option 'migprior' is obsolete"

Problem: You are using the old migprior option which was replaced in v4.8.0.

Solution: Replace migprior with wprior. Note the parameterization has changed:

  • Old: M_{XY} = m_{XY} \cdot N_Y (population migration rate)
  • New: w_{XY} = m_{XY} / \mu (mutation-scaled migration rate)

Convert using: w_{XY} = 4 M_{XY} / \theta_Y

"Option 'outfile' and 'mcmcfile' are now obsolete"

Problem: These options have been replaced by jobname.

Solution: Replace both options with a single jobname line:

# Old (no longer works):
outfile = results.txt
mcmcfile = results.mcmc.txt

# New:
jobname = results

"Option 'diploid' was renamed to 'phase'"

Problem: The option name changed but the syntax is the same.

Solution: Simply rename diploid to phase in your control file.

"Erroneous format of 'clock'"

Problem: Invalid clock specification.

Solution: Valid clock options are:

clock = 1                                 # strict clock (default)
clock = 2 a_vbar b_vbar a_vi prior dist   # independent rates
clock = 3 a_vbar b_vbar a_vi prior dist   # correlated rates
clock = 4 a_vbar b_vbar                   # simple rates

MCMC Issues

MCMC not converging / poor mixing

Symptoms: ESS values are low, trace plots show trends or poor mixing.

Solutions:

  1. Increase run length: Increase burnin and nsample
  2. Adjust step sizes: Set finetune = 0 initially to let BPP auto-tune, then examine the acceptance rates in the output
  3. Check priors: Ensure priors are appropriate for your data scale
  4. Run multiple chains: Use different seeds (seed = -1) and compare results
  5. Simplify the model: Start with a simpler model (e.g., JC69 instead of GTR)

Acceptance rates too low or too high

Problem: MCMC proposals are being rejected too often (< 20%) or accepted too often (> 80%).

Solution: Adjust the finetune parameters:

  • Low acceptance rate → decrease step size
  • High acceptance rate → increase step size

Let BPP auto-tune first (finetune = 1), then manually adjust if needed.

"NaN" or "Inf" in output

Problem: Numerical overflow or underflow occurred.

Solutions:

  • Check that sequence data is valid (no unusual characters)
  • Ensure prior parameters are reasonable
  • Try using cleandata = 1 to remove ambiguous sites
  • Check for very short or very long branch lengths in starting tree

Data Issues

"Number of sequences does not match"

Problem: Mismatch between Imap file and sequence file.

Solution: Ensure every sequence in the sequence file has a corresponding entry in the Imap file, and that sample counts in species&tree match.

"Duplicate taxon or node label"

Problem: The same name appears more than once in the species tree.

Solution: Ensure all node labels in your species tree are unique.

Sequences not aligning with species

Problem: Wrong sequences assigned to species.

Solution: Check your Imap file carefully. Format is:

sequence_name    species_name

Memory and Performance

Out of memory errors

Solutions:

  • Reduce number of threads: threads = 1
  • Analyze fewer loci: reduce nloci
  • Use a machine with more RAM

Analysis running very slowly

Solutions:

  • Increase threads: threads = N (where N = number of CPU cores)
  • Use loadbalance = zigzag for better thread utilization
  • Use simpler substitution model
  • Reduce number of loci for initial testing

Getting Help

If you cannot resolve your issue:

  1. Check the BPP GitHub issues
  2. Post on the BPP discussion forum
  3. Include in your report:
    • BPP version (bpp --version)
    • Operating system
    • Complete error message
    • Minimal control file that reproduces the issue

Common Recipes

This section provides step-by-step instructions for common analysis tasks.

Recipe 1: Basic Parameter Estimation (A00)

Goal: Estimate divergence times and population sizes for a known species tree.

Control file:

seed = -1
seqfile = sequences.txt
Imapfile = species_map.txt
jobname = A00_analysis

speciesdelimitation = 0    # fixed delimitation
speciestree = 0            # fixed tree

species&tree = 3  A  B  C
                  5  5  5
                  ((A, B), C);

usedata = 1
nloci = 100
cleandata = 0

thetaprior = invgamma 3 0.002
tauprior = invgamma 3 0.03

finetune = 1
print = 1 0 0 0 0
burnin = 10000
sampfreq = 10
nsample = 100000

Key points:

  • Set speciesdelimitation = 0 and speciestree = 0
  • Provide your species tree in Newick format
  • Adjust priors based on expected θ and τ values

Recipe 2: Species Tree Estimation (A01)

Goal: Infer the species tree when species assignments are known.

Control file:

seed = -1
seqfile = sequences.txt
Imapfile = species_map.txt
jobname = A01_analysis

speciesdelimitation = 0    # fixed delimitation
speciestree = 1            # estimate tree

species&tree = 4  A  B  C  D
                  5  5  5  5
                  ((A, B), (C, D));   # starting tree

usedata = 1
nloci = 100

thetaprior = invgamma 3 0.002
tauprior = invgamma 3 0.03

finetune = 1
burnin = 20000
sampfreq = 10
nsample = 200000

Key points:

  • Set speciestree = 1 to estimate the tree topology
  • The tree in species&tree is just a starting tree
  • Run longer chains (more nsample) for tree estimation

Recipe 3: Species Delimitation with Guide Tree (A10)

Goal: Test species boundaries using a fixed guide tree.

Control file:

seed = -1
seqfile = sequences.txt
Imapfile = species_map.txt
jobname = A10_analysis

speciesdelimitation = 1 1 2 1    # rjMCMC algorithm 1
speciestree = 0                  # fixed guide tree

species&tree = 4  A  B  C  D
                  5  5  5  5
                  ((A, B), (C, D));

usedata = 1
nloci = 100

thetaprior = invgamma 3 0.002
tauprior = invgamma 3 0.03
speciesmodelprior = 1    # uniform prior on models

finetune = 1
burnin = 20000
sampfreq = 10
nsample = 200000

Key points:

  • speciesdelimitation = 1 enables delimitation
  • The additional parameters control the rjMCMC algorithm
  • Output includes posterior probabilities for different delimitation models

Recipe 4: Adding Migration (MSC-M)

Goal: Estimate migration rates between populations.

Control file:

seed = -1
seqfile = sequences.txt
Imapfile = species_map.txt
jobname = MSCM_analysis

speciesdelimitation = 0
speciestree = 0

species&tree = 3  A  B  C
                  10 10 10
                  ((A, B)AB, C)R;    # label internal nodes!

usedata = 1
nloci = 100

thetaprior = invgamma 3 0.002
tauprior = invgamma 3 0.03

# Migration setup
wprior = 2 200              # gamma prior on migration rates
migration = 1               # number of migration bands
  A B                       # migration from A to B

finetune = 1
burnin = 20000
sampfreq = 10
nsample = 200000

Key points:

  • Label internal nodes in the species tree (e.g., AB, R)
  • Use wprior (not migprior) for BPP v4.8.0+
  • Specify migration connections with source and target populations

Recipe 5: Adding Introgression (MSC-I)

Goal: Model introgression/hybridization events.

Control file:

seed = -1
seqfile = sequences.txt
Imapfile = species_map.txt
jobname = MSCI_analysis

speciesdelimitation = 0
speciestree = 0

species&tree = 3  A  B  C
                  10 10 10
                  ((A, B)AB, C)R;

usedata = 1
nloci = 100

thetaprior = invgamma 3 0.002
tauprior = invgamma 3 0.03
phiprior = beta 1 1         # prior on introgression probability

# Introgression: from branch leading to A into branch leading to C
hybridization = R A, AB C as S H tau=yes, no phi=0.1

finetune = 1
burnin = 20000
sampfreq = 10
nsample = 200000

Key points:

  • Use phiprior to set prior on introgression probability
  • hybridization defines the introgression event
  • See MSC-I documentation for full syntax options

Recipe 6: Relaxed Clock Analysis

Goal: Allow substitution rate variation among lineages.

Control file:

seed = -1
seqfile = sequences.txt
Imapfile = species_map.txt
jobname = relaxed_clock

speciesdelimitation = 0
speciestree = 0

species&tree = 3  A  B  C
                  10 10 10
                  ((A, B), C);

usedata = 1
nloci = 100

thetaprior = invgamma 3 0.002
tauprior = invgamma 3 0.03

# Relaxed clock with independent rates among branches
clock = 2 10.0 100.0 5.0 iid G

finetune = 1
burnin = 20000
sampfreq = 10
nsample = 200000

Clock options:

  • clock = 1 — strict clock (default)
  • clock = 2 ... iid G — independent rates, gamma distributed
  • clock = 3 ... iid G — autocorrelated rates
  • clock = 4 a b — simple rates model

Glossary

Parameters

Symbol Name Description
θ (theta) Population size parameter \theta = 4N\mu, where N is effective population size and μ is mutation rate
τ (tau) Divergence time Time of species divergence, measured in expected substitutions per site
φ (phi) Introgression probability Probability that a lineage follows the introgression path (MSC-I model)
w Migration rate Mutation-scaled migration rate: w_{XY} = m_{XY}/\mu (MSC-M model, v4.8.0+)
M Population migration rate M_{XY} = m_{XY} \cdot N_Y, expected migrants per generation (pre-v4.8.0)

Models

Term Description
MSC Multispecies Coalescent — the basic model relating gene trees to species trees
MSC-I MSC with Introgression — allows hybridization/introgression events
MSC-M MSC with Migration — allows continuous gene flow between populations
IM Isolation with Migration — another name for the MSC-M model

Analysis Types

Code Name Description
A00 Parameter estimation Fixed species tree and delimitation, estimate θ and τ
A01 Species tree estimation Fixed delimitation, estimate species tree topology
A10 Species delimitation Fixed guide tree, test alternative delimitations
A11 Joint estimation Simultaneously estimate tree and delimitation

MCMC Terms

Term Description
Burn-in Initial MCMC iterations discarded before sampling
ESS Effective Sample Size — measure of independent samples in MCMC output
Mixing How well the MCMC explores parameter space
Convergence When the MCMC has reached the stationary distribution
Chain A single MCMC run
Proposal A suggested move in parameter space
Acceptance rate Fraction of proposals accepted

Priors

Prior Syntax Use
Inverse-gamma invgamma a b Conjugate prior for θ; allows analytical integration
Gamma gamma a b Alternative prior for θ and τ
Beta beta a b Prior for bounded parameters like φ
Dirichlet dir Prior for rate variation among loci

File Types

File Description
Control file Main configuration file (.ctl) specifying all analysis options
Sequence file Phylip-format alignment of DNA/protein sequences
Imap file Maps individual sequences to species
MCMC file Output file containing posterior samples (.mcmc.txt)
Checkpoint file Saved state for resuming analysis (.chk)

Substitution Models

Model Description
JC69 Jukes-Cantor — equal rates, equal frequencies
K80 Kimura 2-parameter — transition/transversion bias
F81 Felsenstein 1981 — unequal base frequencies
HKY Hasegawa-Kishino-Yano — K80 + F81
GTR General Time Reversible — most general reversible model